\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127678069:

Variant ID: vg1127678069 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27678069
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGTGTTGGTGTGCAGTTTTTTCTCTTGTGTGTGCTGCCCATTTCTACACGCACTCCACATGAATGCTGAAAATTTTTGGTCAAATTGAGAGAGAAGAT[C/T]
GAGCTGGGATGAAGATCAATCCATGCGCGCTTGACGGTCAGGTAGGGCACACACTTCTTGTGAAAGTTCAGACCAATTGACAGGTAGATGACCTCTTCTT

Reverse complement sequence

AAGAAGAGGTCATCTACCTGTCAATTGGTCTGAACTTTCACAAGAAGTGTGTGCCCTACCTGACCGTCAAGCGCGCATGGATTGATCTTCATCCCAGCTC[G/A]
ATCTTCTCTCTCAATTTGACCAAAAATTTTCAGCATTCATGTGGAGTGCGTGTAGAAATGGGCAGCACACACAAGAGAAAAAACTGCACACCAACACACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 18.30% 0.21% 0.00% NA
All Indica  2759 89.00% 10.80% 0.22% 0.00% NA
All Japonica  1512 66.60% 33.30% 0.13% 0.00% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 69.70% 30.10% 0.17% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 96.10% 3.80% 0.11% 0.00% NA
Indica Intermediate  786 90.80% 8.70% 0.51% 0.00% NA
Temperate Japonica  767 72.90% 27.00% 0.13% 0.00% NA
Tropical Japonica  504 57.30% 42.50% 0.20% 0.00% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127678069 C -> T LOC_Os11g45740.1 upstream_gene_variant ; 4735.0bp to feature; MODIFIER silent_mutation Average:77.276; most accessible tissue: Callus, score: 90.177 N N N N
vg1127678069 C -> T LOC_Os11g45740-LOC_Os11g45750 intergenic_region ; MODIFIER silent_mutation Average:77.276; most accessible tissue: Callus, score: 90.177 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127678069 C T 0.08 0.04 0.03 0.0 0.02 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127678069 3.26E-06 1.12E-08 mr1592 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127678069 NA 9.18E-06 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127678069 NA 7.69E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127678069 NA 2.33E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251