Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127651021:

Variant ID: vg1127651021 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27651021
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TGACATTAGATCAAACACATCTTAAACCAAAAAAAGGAGATGAGAATAAAATAAGTGTATGGAATCTAAATGTGTACTATTATACAAATAGTAAACCCAT[G/A]
TAGTAATTACCTGAAGAAGTTGAACTTTCCATTTCCAAGACTCTTTTTATTTACTTCATCAAGAAAAAAGTAATAACCTACAAAAGATTCCAAACTAGAT

Reverse complement sequence

ATCTAGTTTGGAATCTTTTGTAGGTTATTACTTTTTTCTTGATGAAGTAAATAAAAAGAGTCTTGGAAATGGAAAGTTCAACTTCTTCAGGTAATTACTA[C/T]
ATGGGTTTACTATTTGTATAATAGTACACATTTAGATTCCATACACTTATTTTATTCTCATCTCCTTTTTTTGGTTTAAGATGTGTTTGATCTAATGTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.70%	19.30%	0.02%	0.00%	NA
All Indica	2759	73.40%	26.50%	0.04%	0.00%	NA
All Japonica	1512	89.60%	10.40%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	93.80%	6.20%	0.00%	0.00%	NA
Indica II	465	93.80%	6.20%	0.00%	0.00%	NA
Indica III	913	49.40%	50.60%	0.00%	0.00%	NA
Indica Intermediate	786	73.90%	26.00%	0.13%	0.00%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	74.00%	26.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127651021	G -> A	LOC_Os11g45710.7	3_prime_UTR_variant ; 235.0bp to feature; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N
vg1127651021	G -> A	LOC_Os11g45710.1	intron_variant ; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N
vg1127651021	G -> A	LOC_Os11g45710.2	intron_variant ; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N
vg1127651021	G -> A	LOC_Os11g45710.3	intron_variant ; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N
vg1127651021	G -> A	LOC_Os11g45710.4	intron_variant ; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N
vg1127651021	G -> A	LOC_Os11g45710.6	intron_variant ; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N
vg1127651021	G -> A	LOC_Os11g45710.5	intron_variant ; MODIFIER	silent_mutation	Average:48.074; most accessible tissue: Callus, score: 77.539	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127651021	7.23E-07	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021	1.87E-06	3.21E-14	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021	NA	1.85E-07	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021	7.82E-08	1.28E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021	2.49E-06	1.72E-13	mr1133_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021	NA	2.52E-09	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251