\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127651021:

Variant ID: vg1127651021 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27651021
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGACATTAGATCAAACACATCTTAAACCAAAAAAAGGAGATGAGAATAAAATAAGTGTATGGAATCTAAATGTGTACTATTATACAAATAGTAAACCCAT[G/A]
TAGTAATTACCTGAAGAAGTTGAACTTTCCATTTCCAAGACTCTTTTTATTTACTTCATCAAGAAAAAAGTAATAACCTACAAAAGATTCCAAACTAGAT

Reverse complement sequence

ATCTAGTTTGGAATCTTTTGTAGGTTATTACTTTTTTCTTGATGAAGTAAATAAAAAGAGTCTTGGAAATGGAAAGTTCAACTTCTTCAGGTAATTACTA[C/T]
ATGGGTTTACTATTTGTATAATAGTACACATTTAGATTCCATACACTTATTTTATTCTCATCTCCTTTTTTTGGTTTAAGATGTGTTTGATCTAATGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 19.30% 0.02% 0.00% NA
All Indica  2759 73.40% 26.50% 0.04% 0.00% NA
All Japonica  1512 89.60% 10.40% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 49.40% 50.60% 0.00% 0.00% NA
Indica Intermediate  786 73.90% 26.00% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 74.00% 26.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127651021 G -> A LOC_Os11g45710.7 3_prime_UTR_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N
vg1127651021 G -> A LOC_Os11g45710.1 intron_variant ; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N
vg1127651021 G -> A LOC_Os11g45710.2 intron_variant ; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N
vg1127651021 G -> A LOC_Os11g45710.3 intron_variant ; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N
vg1127651021 G -> A LOC_Os11g45710.4 intron_variant ; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N
vg1127651021 G -> A LOC_Os11g45710.6 intron_variant ; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N
vg1127651021 G -> A LOC_Os11g45710.5 intron_variant ; MODIFIER silent_mutation Average:48.074; most accessible tissue: Callus, score: 77.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127651021 7.23E-07 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021 1.87E-06 3.21E-14 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021 NA 1.85E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021 7.82E-08 1.28E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021 2.49E-06 1.72E-13 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127651021 NA 2.52E-09 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251