\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127582186:

Variant ID: vg1127582186 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27582186
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


TATATCGTCTTCTATCCTTTTCATGCATCTTGTACCATATAAGCCAATAACAATTTGGTCAGAATCTCTAAACATTGTGTACGTTATTAACCATTAGAGA[T/C]
ACCTATGATATCAATTACTAACAGTAAATTCCTACCAGAAAAGATATTGGCCCCCGTGTCTTTCTGCTTGGGGCAACAATGGTGGTGATTCAGGCTGCCA

Reverse complement sequence

TGGCAGCCTGAATCACCACCATTGTTGCCCCAAGCAGAAAGACACGGGGGCCAATATCTTTTCTGGTAGGAATTTACTGTTAGTAATTGATATCATAGGT[A/G]
TCTCTAATGGTTAATAACGTACACAATGTTTAGAGATTCTGACCAAATTGTTATTGGCTTATATGGTACAAGATGCATGAAAAGGATAGAAGACGATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 31.90% 0.55% 12.51% NA
All Indica  2759 50.70% 32.60% 0.80% 15.95% NA
All Japonica  1512 67.80% 29.80% 0.00% 2.45% NA
Aus  269 18.60% 37.90% 1.49% 42.01% NA
Indica I  595 67.20% 8.70% 1.85% 22.18% NA
Indica II  465 84.70% 9.20% 0.43% 5.59% NA
Indica III  913 22.10% 60.10% 0.22% 17.52% NA
Indica Intermediate  786 51.10% 32.40% 0.89% 15.52% NA
Temperate Japonica  767 86.20% 9.10% 0.00% 4.69% NA
Tropical Japonica  504 39.70% 60.10% 0.00% 0.20% NA
Japonica Intermediate  241 68.00% 32.00% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127582186 T -> DEL N N silent_mutation Average:10.735; most accessible tissue: Callus, score: 54.484 N N N N
vg1127582186 T -> C LOC_Os11g45560.1 upstream_gene_variant ; 2904.0bp to feature; MODIFIER silent_mutation Average:10.735; most accessible tissue: Callus, score: 54.484 N N N N
vg1127582186 T -> C LOC_Os11g45570.1 downstream_gene_variant ; 32.0bp to feature; MODIFIER silent_mutation Average:10.735; most accessible tissue: Callus, score: 54.484 N N N N
vg1127582186 T -> C LOC_Os11g45580.1 downstream_gene_variant ; 1437.0bp to feature; MODIFIER silent_mutation Average:10.735; most accessible tissue: Callus, score: 54.484 N N N N
vg1127582186 T -> C LOC_Os11g45560-LOC_Os11g45570 intergenic_region ; MODIFIER silent_mutation Average:10.735; most accessible tissue: Callus, score: 54.484 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127582186 6.63E-08 NA mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186 1.12E-07 5.65E-15 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186 5.26E-06 NA mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186 1.50E-06 1.20E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186 3.37E-07 3.33E-13 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186 NA 7.47E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251