\
| Variant ID: vg1127580369 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27580369 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 103. )
AAAGCCCATTAATTGCTTTCTTTTCAGCCCTAGCTCAGACCGTAGGTTTTGACCATAATTAGATCAACGCATCTCATCCACAAATCGATTAATTTGTAGA[T/C]
GTGAATTAGATCGAGTTCGAGACGAAAGGAATCATTGAAAAACAGAAAGACTCGGAAATTTTTTTTTAATAATGGATTAAATCGGTCTCTACACCCAAAG
CTTTGGGTGTAGAGACCGATTTAATCCATTATTAAAAAAAAATTTCCGAGTCTTTCTGTTTTTCAATGATTCCTTTCGTCTCGAACTCGATCTAATTCAC[A/G]
TCTACAAATTAATCGATTTGTGGATGAGATGCGTTGATCTAATTATGGTCAAAACCTACGGTCTGAGCTAGGGCTGAAAAGAAAGCAATTAATGGGCTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 31.50% | 1.33% | 11.93% | NA |
| All Indica | 2759 | 51.00% | 32.10% | 1.27% | 15.62% | NA |
| All Japonica | 1512 | 67.70% | 29.70% | 1.52% | 1.06% | NA |
| Aus | 269 | 18.60% | 36.80% | 1.49% | 43.12% | NA |
| Indica I | 595 | 67.20% | 8.70% | 3.36% | 20.67% | NA |
| Indica II | 465 | 84.70% | 9.50% | 0.22% | 5.59% | NA |
| Indica III | 913 | 22.60% | 59.50% | 0.44% | 17.52% | NA |
| Indica Intermediate | 786 | 51.90% | 31.30% | 1.27% | 15.52% | NA |
| Temperate Japonica | 767 | 86.20% | 9.00% | 2.87% | 1.96% | NA |
| Tropical Japonica | 504 | 39.50% | 60.10% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 31.10% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127580369 | T -> DEL | N | N | silent_mutation | Average:10.939; most accessible tissue: Callus, score: 42.231 | N | N | N | N |
| vg1127580369 | T -> C | LOC_Os11g45550.1 | upstream_gene_variant ; 4341.0bp to feature; MODIFIER | silent_mutation | Average:10.939; most accessible tissue: Callus, score: 42.231 | N | N | N | N |
| vg1127580369 | T -> C | LOC_Os11g45560.1 | upstream_gene_variant ; 1087.0bp to feature; MODIFIER | silent_mutation | Average:10.939; most accessible tissue: Callus, score: 42.231 | N | N | N | N |
| vg1127580369 | T -> C | LOC_Os11g45570.1 | downstream_gene_variant ; 1849.0bp to feature; MODIFIER | silent_mutation | Average:10.939; most accessible tissue: Callus, score: 42.231 | N | N | N | N |
| vg1127580369 | T -> C | LOC_Os11g45580.1 | downstream_gene_variant ; 3254.0bp to feature; MODIFIER | silent_mutation | Average:10.939; most accessible tissue: Callus, score: 42.231 | N | N | N | N |
| vg1127580369 | T -> C | LOC_Os11g45560-LOC_Os11g45570 | intergenic_region ; MODIFIER | silent_mutation | Average:10.939; most accessible tissue: Callus, score: 42.231 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127580369 | 1.70E-07 | NA | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127580369 | 1.75E-07 | 1.40E-14 | mr1133 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127580369 | 8.69E-06 | 6.99E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127580369 | 6.71E-07 | 1.81E-12 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127580369 | NA | 3.37E-06 | mr1403_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127580369 | NA | 2.73E-07 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |