\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127580369:

Variant ID: vg1127580369 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27580369
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.14, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGCCCATTAATTGCTTTCTTTTCAGCCCTAGCTCAGACCGTAGGTTTTGACCATAATTAGATCAACGCATCTCATCCACAAATCGATTAATTTGTAGA[T/C]
GTGAATTAGATCGAGTTCGAGACGAAAGGAATCATTGAAAAACAGAAAGACTCGGAAATTTTTTTTTAATAATGGATTAAATCGGTCTCTACACCCAAAG

Reverse complement sequence

CTTTGGGTGTAGAGACCGATTTAATCCATTATTAAAAAAAAATTTCCGAGTCTTTCTGTTTTTCAATGATTCCTTTCGTCTCGAACTCGATCTAATTCAC[A/G]
TCTACAAATTAATCGATTTGTGGATGAGATGCGTTGATCTAATTATGGTCAAAACCTACGGTCTGAGCTAGGGCTGAAAAGAAAGCAATTAATGGGCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 31.50% 1.33% 11.93% NA
All Indica  2759 51.00% 32.10% 1.27% 15.62% NA
All Japonica  1512 67.70% 29.70% 1.52% 1.06% NA
Aus  269 18.60% 36.80% 1.49% 43.12% NA
Indica I  595 67.20% 8.70% 3.36% 20.67% NA
Indica II  465 84.70% 9.50% 0.22% 5.59% NA
Indica III  913 22.60% 59.50% 0.44% 17.52% NA
Indica Intermediate  786 51.90% 31.30% 1.27% 15.52% NA
Temperate Japonica  767 86.20% 9.00% 2.87% 1.96% NA
Tropical Japonica  504 39.50% 60.10% 0.20% 0.20% NA
Japonica Intermediate  241 68.00% 32.00% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 66.70% 31.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127580369 T -> DEL N N silent_mutation Average:10.939; most accessible tissue: Callus, score: 42.231 N N N N
vg1127580369 T -> C LOC_Os11g45550.1 upstream_gene_variant ; 4341.0bp to feature; MODIFIER silent_mutation Average:10.939; most accessible tissue: Callus, score: 42.231 N N N N
vg1127580369 T -> C LOC_Os11g45560.1 upstream_gene_variant ; 1087.0bp to feature; MODIFIER silent_mutation Average:10.939; most accessible tissue: Callus, score: 42.231 N N N N
vg1127580369 T -> C LOC_Os11g45570.1 downstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:10.939; most accessible tissue: Callus, score: 42.231 N N N N
vg1127580369 T -> C LOC_Os11g45580.1 downstream_gene_variant ; 3254.0bp to feature; MODIFIER silent_mutation Average:10.939; most accessible tissue: Callus, score: 42.231 N N N N
vg1127580369 T -> C LOC_Os11g45560-LOC_Os11g45570 intergenic_region ; MODIFIER silent_mutation Average:10.939; most accessible tissue: Callus, score: 42.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127580369 1.70E-07 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369 1.75E-07 1.40E-14 mr1133 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369 8.69E-06 6.99E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369 6.71E-07 1.81E-12 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369 NA 3.37E-06 mr1403_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127580369 NA 2.73E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251