\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127574082:

Variant ID: vg1127574082 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27574082
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGTTGGATTGGTAGATGCTGTTCGCCGTGTATTTGCTGCTGCCGCAGATCATCCAGGGCTGGGCGGCGACCATAGGCATCGGCAAGAAGAAGAAGCAG[C/A]
AGCCAAGGATGAGCAGGACGGTGAGAATCATGGCTAGCTATGCTGCCTCACGCGTAAGCGTAAGGTTTCTCTGAATCTCTTGCATTCCAAAGACAGGGTC

Reverse complement sequence

GACCCTGTCTTTGGAATGCAAGAGATTCAGAGAAACCTTACGCTTACGCGTGAGGCAGCATAGCTAGCCATGATTCTCACCGTCCTGCTCATCCTTGGCT[G/T]
CTGCTTCTTCTTCTTGCCGATGCCTATGGTCGCCGCCCAGCCCTGGATGATCTGCGGCAGCAGCAAATACACGGCGAACAGCATCTACCAATCCAACCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 43.90% 0.36% 0.34% NA
All Indica  2759 50.90% 48.50% 0.43% 0.22% NA
All Japonica  1512 69.40% 29.80% 0.20% 0.60% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 68.90% 30.60% 0.34% 0.17% NA
Indica II  465 85.20% 14.40% 0.43% 0.00% NA
Indica III  913 19.80% 79.60% 0.55% 0.00% NA
Indica Intermediate  786 53.10% 45.90% 0.38% 0.64% NA
Temperate Japonica  767 90.10% 9.10% 0.26% 0.52% NA
Tropical Japonica  504 38.90% 60.30% 0.20% 0.60% NA
Japonica Intermediate  241 67.20% 32.00% 0.00% 0.83% NA
VI/Aromatic  96 64.60% 34.40% 1.04% 0.00% NA
Intermediate  90 65.60% 32.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127574082 C -> A LOC_Os11g45540.1 missense_variant ; p.Cys11Phe; MODERATE nonsynonymous_codon ; C11F Average:87.483; most accessible tissue: Minghui63 young leaf, score: 94.665 unknown unknown TOLERATED 0.28
vg1127574082 C -> DEL LOC_Os11g45540.1 N frameshift_variant Average:87.483; most accessible tissue: Minghui63 young leaf, score: 94.665 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127574082 C A 0.02 -0.01 -0.01 0.0 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127574082 NA 1.45E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 4.91E-06 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 7.80E-12 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 2.87E-06 NA mr1322 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 4.56E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 1.23E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 3.42E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 9.55E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 1.14E-10 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127574082 NA 2.16E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251