\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127563288:

Variant ID: vg1127563288 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27563288
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTGGCGATGGCACTTCAAGTTGGGACAACTCTGTCCTTATAAAACTGATCATCGAGACTGTACCGTTATATGAACAAGTATGTTTTTTCCCCCATTGA[C/G]
TACAACTCATTTGAGTCTGCAAGTCAAATACTGCTGTGAGCAATCAAGAATCTGCATTCTACCCTCCTGTTATGAACTTTTTTAGATTGTAAAGACTCTT

Reverse complement sequence

AAGAGTCTTTACAATCTAAAAAAGTTCATAACAGGAGGGTAGAATGCAGATTCTTGATTGCTCACAGCAGTATTTGACTTGCAGACTCAAATGAGTTGTA[G/C]
TCAATGGGGGAAAAAACATACTTGTTCATATAACGGTACAGTCTCGATGATCAGTTTTATAAGGACAGAGTTGTCCCAACTTGAAGTGCCATCGCCAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.30% 5.00% 0.59% 57.07% NA
All Indica  2759 31.80% 8.20% 0.47% 59.55% NA
All Japonica  1512 48.60% 0.10% 0.93% 50.33% NA
Aus  269 17.50% 0.70% 0.37% 81.41% NA
Indica I  595 17.60% 30.90% 0.34% 51.09% NA
Indica II  465 71.40% 0.60% 0.00% 27.96% NA
Indica III  913 13.70% 1.10% 0.44% 84.78% NA
Indica Intermediate  786 39.90% 3.80% 0.89% 55.34% NA
Temperate Japonica  767 62.30% 0.30% 1.69% 35.72% NA
Tropical Japonica  504 29.20% 0.00% 0.20% 70.63% NA
Japonica Intermediate  241 45.60% 0.00% 0.00% 54.36% NA
VI/Aromatic  96 64.60% 2.10% 0.00% 33.33% NA
Intermediate  90 47.80% 5.60% 0.00% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127563288 C -> DEL N N silent_mutation Average:11.861; most accessible tissue: Callus, score: 85.803 N N N N
vg1127563288 C -> G LOC_Os11g45530.1 splice_region_variant ; LOW silent_mutation Average:11.861; most accessible tissue: Callus, score: 85.803 N N N N
vg1127563288 C -> G LOC_Os11g45530.1 3_prime_UTR_variant ; 928.0bp to feature; MODIFIER silent_mutation Average:11.861; most accessible tissue: Callus, score: 85.803 N N N N
vg1127563288 C -> G LOC_Os11g45520.1 downstream_gene_variant ; 365.0bp to feature; MODIFIER silent_mutation Average:11.861; most accessible tissue: Callus, score: 85.803 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127563288 NA 1.04E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 1.57E-07 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 1.38E-06 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 8.71E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 8.52E-06 8.51E-06 mr1485_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 3.86E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 2.74E-08 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 7.25E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 3.52E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 6.98E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 4.84E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 8.23E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 NA 5.19E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288 4.84E-06 4.86E-06 mr1979_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251