Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127563288:

Variant ID: vg1127563288 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27563288
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTTGGCGATGGCACTTCAAGTTGGGACAACTCTGTCCTTATAAAACTGATCATCGAGACTGTACCGTTATATGAACAAGTATGTTTTTTCCCCCATTGA[C/G]
TACAACTCATTTGAGTCTGCAAGTCAAATACTGCTGTGAGCAATCAAGAATCTGCATTCTACCCTCCTGTTATGAACTTTTTTAGATTGTAAAGACTCTT

Reverse complement sequence

AAGAGTCTTTACAATCTAAAAAAGTTCATAACAGGAGGGTAGAATGCAGATTCTTGATTGCTCACAGCAGTATTTGACTTGCAGACTCAAATGAGTTGTA[G/C]
TCAATGGGGGAAAAAACATACTTGTTCATATAACGGTACAGTCTCGATGATCAGTTTTATAAGGACAGAGTTGTCCCAACTTGAAGTGCCATCGCCAACT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.30%	5.00%	0.59%	57.07%	NA
All Indica	2759	31.80%	8.20%	0.47%	59.55%	NA
All Japonica	1512	48.60%	0.10%	0.93%	50.33%	NA
Aus	269	17.50%	0.70%	0.37%	81.41%	NA
Indica I	595	17.60%	30.90%	0.34%	51.09%	NA
Indica II	465	71.40%	0.60%	0.00%	27.96%	NA
Indica III	913	13.70%	1.10%	0.44%	84.78%	NA
Indica Intermediate	786	39.90%	3.80%	0.89%	55.34%	NA
Temperate Japonica	767	62.30%	0.30%	1.69%	35.72%	NA
Tropical Japonica	504	29.20%	0.00%	0.20%	70.63%	NA
Japonica Intermediate	241	45.60%	0.00%	0.00%	54.36%	NA
VI/Aromatic	96	64.60%	2.10%	0.00%	33.33%	NA
Intermediate	90	47.80%	5.60%	0.00%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127563288	C -> DEL	N	N	silent_mutation	Average:11.861; most accessible tissue: Callus, score: 85.803	N	N	N	N
vg1127563288	C -> G	LOC_Os11g45530.1	splice_region_variant ; LOW	silent_mutation	Average:11.861; most accessible tissue: Callus, score: 85.803	N	N	N	N
vg1127563288	C -> G	LOC_Os11g45530.1	3_prime_UTR_variant ; 928.0bp to feature; MODIFIER	silent_mutation	Average:11.861; most accessible tissue: Callus, score: 85.803	N	N	N	N
vg1127563288	C -> G	LOC_Os11g45520.1	downstream_gene_variant ; 365.0bp to feature; MODIFIER	silent_mutation	Average:11.861; most accessible tissue: Callus, score: 85.803	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127563288	NA	1.04E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	1.57E-07	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	1.38E-06	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	8.71E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	8.52E-06	8.51E-06	mr1485_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	3.86E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	2.74E-08	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	7.25E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	3.52E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	6.98E-07	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	4.84E-06	mr1823_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	8.23E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	NA	5.19E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127563288	4.84E-06	4.86E-06	mr1979_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251