Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127556865:

Variant ID: vg1127556865 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27556865
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GATCCCGAGCTCACAACTGCATTACAAAAGGGAAGCAGAAGCCAAGACTTGGACCAAACATCACAGGCGCGACTTGGGAACTAGGCCGAAACCCTAAAAC[T/A]
CATCGTAGCCGACTTGCTCCTAGAAGAACTCCTCGTCAGCGGGATCCGCTTCATCTTCTTCAGCAACTAGGGAGGATTATTTATATAGAGCAAGGGTGAG

Reverse complement sequence

CTCACCCTTGCTCTATATAAATAATCCTCCCTAGTTGCTGAAGAAGATGAAGCGGATCCCGCTGACGAGGAGTTCTTCTAGGAGCAAGTCGGCTACGATG[A/T]
GTTTTAGGGTTTCGGCCTAGTTCCCAAGTCGCGCCTGTGATGTTTGGTCCAAGTCTTGGCTTCTGCTTCCCTTTTGTAATGCAGTTGTGAGCTCGGGATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.10%	12.50%	1.14%	52.24%	NA
All Indica	2759	27.00%	20.60%	0.98%	51.47%	NA
All Japonica	1512	47.80%	0.80%	0.60%	50.79%	NA
Aus	269	12.60%	0.70%	5.95%	80.67%	NA
Indica I	595	66.40%	1.80%	0.34%	31.43%	NA
Indica II	465	17.00%	66.50%	0.65%	15.91%	NA
Indica III	913	10.50%	5.10%	0.99%	83.35%	NA
Indica Intermediate	786	22.30%	25.40%	1.65%	50.64%	NA
Temperate Japonica	767	62.70%	0.70%	0.26%	36.38%	NA
Tropical Japonica	504	26.60%	1.00%	1.19%	71.23%	NA
Japonica Intermediate	241	44.80%	0.80%	0.41%	53.94%	NA
VI/Aromatic	96	64.60%	2.10%	0.00%	33.33%	NA
Intermediate	90	51.10%	11.10%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127556865	T -> A	LOC_Os11g45510.1	upstream_gene_variant ; 1340.0bp to feature; MODIFIER	silent_mutation	Average:10.648; most accessible tissue: Callus, score: 16.551	N	N	N	N
vg1127556865	T -> A	LOC_Os11g45520.1	upstream_gene_variant ; 4796.0bp to feature; MODIFIER	silent_mutation	Average:10.648; most accessible tissue: Callus, score: 16.551	N	N	N	N
vg1127556865	T -> A	LOC_Os11g45510-LOC_Os11g45520	intergenic_region ; MODIFIER	silent_mutation	Average:10.648; most accessible tissue: Callus, score: 16.551	N	N	N	N
vg1127556865	T -> DEL	N	N	silent_mutation	Average:10.648; most accessible tissue: Callus, score: 16.551	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127556865	NA	1.23E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	9.26E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	7.07E-07	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	1.57E-06	mr1268	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	4.40E-06	1.06E-08	mr1279	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	5.62E-06	5.62E-06	mr1279	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	7.77E-06	mr1477	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	1.72E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	1.33E-06	mr1742	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	1.70E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	1.47E-08	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	4.31E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	1.06E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	2.95E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	2.99E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127556865	NA	4.27E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251