\
| Variant ID: vg1127529196 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27529196 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCAAGTACTTATCTTCTGTCAATGTCTTGAGCGAGTGAAACACTGGTGGAGAAACCATCTTTTGTCGATCGGCCGAATTCCACAATAGTCCCGGTTGCAA[C/T]
AAAAACCGGGACTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAACGGGCATATTTGATCTTTAGTCCTGGTTGGTAACACCAACCTCTTTAGTCCCG
CGGGACTAAAGAGGTTGGTGTTACCAACCAGGACTAAAGATCAAATATGCCCGTTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGTCCCGGTTTTT[G/A]
TTGCAACCGGGACTATTGTGGAATTCGGCCGATCGACAAAAGATGGTTTCTCCACCAGTGTTTCACTCGCTCAAGACATTGACAGAAGATAAGTACTTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 0.30% | 5.76% | 26.22% | NA |
| All Indica | 2759 | 74.00% | 0.30% | 5.87% | 19.90% | NA |
| All Japonica | 1512 | 53.60% | 0.00% | 5.69% | 40.74% | NA |
| Aus | 269 | 75.50% | 1.50% | 5.95% | 17.10% | NA |
| Indica I | 595 | 64.70% | 0.30% | 4.71% | 30.25% | NA |
| Indica II | 465 | 61.90% | 0.20% | 7.74% | 30.11% | NA |
| Indica III | 913 | 85.90% | 0.30% | 4.38% | 9.42% | NA |
| Indica Intermediate | 786 | 74.30% | 0.10% | 7.38% | 18.19% | NA |
| Temperate Japonica | 767 | 46.50% | 0.00% | 2.09% | 51.37% | NA |
| Tropical Japonica | 504 | 64.70% | 0.00% | 10.52% | 24.80% | NA |
| Japonica Intermediate | 241 | 52.70% | 0.00% | 7.05% | 40.25% | NA |
| VI/Aromatic | 96 | 88.50% | 2.10% | 4.17% | 5.21% | NA |
| Intermediate | 90 | 70.00% | 0.00% | 4.44% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127529196 | C -> T | LOC_Os11g45470.1 | upstream_gene_variant ; 794.0bp to feature; MODIFIER | silent_mutation | Average:12.574; most accessible tissue: Callus, score: 33.028 | N | N | N | N |
| vg1127529196 | C -> T | LOC_Os11g45480.1 | upstream_gene_variant ; 1837.0bp to feature; MODIFIER | silent_mutation | Average:12.574; most accessible tissue: Callus, score: 33.028 | N | N | N | N |
| vg1127529196 | C -> T | LOC_Os11g45460-LOC_Os11g45470 | intergenic_region ; MODIFIER | silent_mutation | Average:12.574; most accessible tissue: Callus, score: 33.028 | N | N | N | N |
| vg1127529196 | C -> DEL | N | N | silent_mutation | Average:12.574; most accessible tissue: Callus, score: 33.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127529196 | NA | 8.99E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 1.33E-06 | mr1101 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 8.57E-06 | mr1858 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 8.56E-06 | mr1859 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | 7.70E-06 | 5.38E-06 | mr1072_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 3.98E-06 | mr1075_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 2.54E-07 | mr1098_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | 7.04E-06 | 7.08E-07 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | 2.12E-07 | 2.23E-10 | mr1150_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | 8.59E-07 | 5.13E-07 | mr1200_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 8.47E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | NA | 9.45E-06 | mr1441_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127529196 | 2.18E-06 | 7.96E-08 | mr1861_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |