\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127497936:

Variant ID: vg1127497936 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 27497936
Reference Allele: GAlternative Allele: C,GTGGAGC
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGAGGAGGGGGTGGTCGCCGAGGCGGGAGAAGCCGGCGCGCGGGAACTCCGCGACGGCCGGGTGCGGGTGGTCGGCGAGGAGGGCGAGAGTAGATGGAG[G/C,GTGGAGC]
GCATTGTTGCGTGGAGGCGGTAGTGGTTACGCGGCAGGAGGAGGAAGTGGTGGCGAGGAGGAGGCGTGGCGGCGGCCGGTGGATGCGACGGCGGTGGATG

Reverse complement sequence

CATCCACCGCCGTCGCATCCACCGGCCGCCGCCACGCCTCCTCCTCGCCACCACTTCCTCCTCCTGCCGCGTAACCACTACCGCCTCCACGCAACAATGC[C/G,GCTCCAC]
CTCCATCTACTCTCGCCCTCCTCGCCGACCACCCGCACCCGGCCGTCGCGGAGTTCCCGCGCGCCGGCTTCTCCCGCCTCGGCGACCACCCCCTCCTCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 40.50% 0.36% 0.00% GTGGAGC: 11.85%
All Indica  2759 35.70% 48.50% 0.40% 0.00% GTGGAGC: 15.40%
All Japonica  1512 69.90% 29.80% 0.20% 0.00% GTGGAGC: 0.13%
Aus  269 42.80% 8.60% 0.00% 0.00% GTGGAGC: 48.70%
Indica I  595 29.10% 45.20% 0.50% 0.00% GTGGAGC: 25.21%
Indica II  465 24.10% 73.50% 0.43% 0.00% GTGGAGC: 1.94%
Indica III  913 44.80% 40.00% 0.55% 0.00% GTGGAGC: 14.68%
Indica Intermediate  786 36.90% 46.20% 0.13% 0.00% GTGGAGC: 16.79%
Temperate Japonica  767 79.40% 20.50% 0.13% 0.00% NA
Tropical Japonica  504 58.90% 40.70% 0.00% 0.00% GTGGAGC: 0.40%
Japonica Intermediate  241 62.70% 36.50% 0.83% 0.00% NA
VI/Aromatic  96 30.20% 67.70% 1.04% 0.00% GTGGAGC: 1.04%
Intermediate  90 56.70% 40.00% 2.22% 0.00% GTGGAGC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127497936 G -> GTGGAGC LOC_Os11g45410.1 upstream_gene_variant ; 235.0bp to feature; MODIFIER silent_mutation Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg1127497936 G -> GTGGAGC LOC_Os11g45420.1 upstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg1127497936 G -> GTGGAGC LOC_Os11g45410-LOC_Os11g45420 intergenic_region ; MODIFIER silent_mutation Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg1127497936 G -> C LOC_Os11g45410.1 upstream_gene_variant ; 234.0bp to feature; MODIFIER silent_mutation Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg1127497936 G -> C LOC_Os11g45420.1 upstream_gene_variant ; 889.0bp to feature; MODIFIER silent_mutation Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N
vg1127497936 G -> C LOC_Os11g45410-LOC_Os11g45420 intergenic_region ; MODIFIER silent_mutation Average:97.602; most accessible tissue: Minghui63 panicle, score: 98.511 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127497936 G C -0.01 -0.02 -0.04 -0.02 -0.03 -0.03
vg1127497936 G GTGGA* -0.04 -0.03 0.05 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127497936 4.10E-06 8.24E-10 mr1299 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 2.12E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 4.61E-06 mr1440 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 4.53E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 5.63E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 1.79E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 2.65E-07 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 1.09E-06 NA mr1924 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 5.06E-06 mr1924 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127497936 NA 4.98E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251