\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127494061:

Variant ID: vg1127494061 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27494061
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, C: 0.35, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TATACTGCAGATACAGCCTGCCAATACTGCAGACACAGCCTGCTACAGAATCACTGTCCATGCCACTGTATAGATAGGATGACTTCCAACAACCCAACAA[C/G]
TAAATGAAGACATATGTGAATGTGAGCTCTAAAAAAATTGAATTAGTTGTGTTAAGATGTTTACTTGATTATATTAACAACTGATGGTCATTACATAAGC

Reverse complement sequence

GCTTATGTAATGACCATCAGTTGTTAATATAATCAAGTAAACATCTTAACACAACTAATTCAATTTTTTTAGAGCTCACATTCACATATGTCTTCATTTA[G/C]
TTGTTGGGTTGTTGGAAGTCATCCTATCTATACAGTGGCATGGACAGTGATTCTGTAGCAGGCTGTGTCTGCAGTATTGGCAGGCTGTATCTGCAGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 23.10% 0.00% 0.00% NA
All Indica  2759 82.40% 17.60% 0.00% 0.00% NA
All Japonica  1512 64.60% 35.40% 0.00% 0.00% NA
Aus  269 91.40% 8.60% 0.00% 0.00% NA
Indica I  595 75.60% 24.40% 0.00% 0.00% NA
Indica II  465 83.00% 17.00% 0.00% 0.00% NA
Indica III  913 82.10% 17.90% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 12.60% 0.00% 0.00% NA
Temperate Japonica  767 56.50% 43.50% 0.00% 0.00% NA
Tropical Japonica  504 75.40% 24.60% 0.00% 0.00% NA
Japonica Intermediate  241 68.00% 32.00% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127494061 C -> G LOC_Os11g45420.1 upstream_gene_variant ; 4764.0bp to feature; MODIFIER silent_mutation Average:66.734; most accessible tissue: Callus, score: 78.831 N N N N
vg1127494061 C -> G LOC_Os11g45400.1 downstream_gene_variant ; 3792.0bp to feature; MODIFIER silent_mutation Average:66.734; most accessible tissue: Callus, score: 78.831 N N N N
vg1127494061 C -> G LOC_Os11g45410.1 intron_variant ; MODIFIER silent_mutation Average:66.734; most accessible tissue: Callus, score: 78.831 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127494061 C G -0.23 -0.04 -0.02 -0.02 -0.06 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127494061 NA 5.56E-06 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127494061 NA 5.10E-06 mr1271 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127494061 NA 3.17E-08 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127494061 2.02E-06 1.18E-07 mr1295 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127494061 NA 4.15E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127494061 NA 1.37E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251