\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127461949:

Variant ID: vg1127461949 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27461949
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATTCCTTGTTTTCAACCCTGGCAGATCAGTGATGAATTGTCTGTATCTCCATGGTTTGGCATATAAGCAAATGGAGATTTGCTCCGGTCCAACAAAAA[G/A,C]
TATCTCGAGGTACAAATATCTCGCGATACCAAATTGTTTCCAATTGTTGGATCTAACAATGCCATTCTGCCCAGCTGGATTTAAGGATCGGAAACGATTT

Reverse complement sequence

AAATCGTTTCCGATCCTTAAATCCAGCTGGGCAGAATGGCATTGTTAGATCCAACAATTGGAAACAATTTGGTATCGCGAGATATTTGTACCTCGAGATA[C/T,G]
TTTTTGTTGGACCGGAGCAAATCTCCATTTGCTTATATGCCAAACCATGGAGATACAGACAATTCATCACTGATCTGCCAGGGTTGAAAACAAGGAATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 20.00% 0.30% 20.27% C: 0.02%
All Indica  2759 59.00% 24.70% 0.22% 16.02% C: 0.04%
All Japonica  1512 65.70% 5.20% 0.46% 28.70% NA
Aus  269 38.30% 41.30% 0.37% 20.07% NA
Indica I  595 63.50% 30.90% 0.00% 5.55% NA
Indica II  465 86.00% 3.90% 0.00% 10.11% NA
Indica III  913 47.30% 30.70% 0.33% 21.58% C: 0.11%
Indica Intermediate  786 53.30% 25.30% 0.38% 20.99% NA
Temperate Japonica  767 80.70% 0.90% 0.13% 18.25% NA
Tropical Japonica  504 44.40% 11.10% 0.99% 43.45% NA
Japonica Intermediate  241 62.20% 6.20% 0.41% 31.12% NA
VI/Aromatic  96 22.90% 67.70% 0.00% 9.38% NA
Intermediate  90 67.80% 11.10% 0.00% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127461949 G -> A LOC_Os11g45380-LOC_Os11g45390 intergenic_region ; MODIFIER silent_mutation Average:20.517; most accessible tissue: Callus, score: 75.436 N N N N
vg1127461949 G -> DEL N N silent_mutation Average:20.517; most accessible tissue: Callus, score: 75.436 N N N N
vg1127461949 G -> C LOC_Os11g45380-LOC_Os11g45390 intergenic_region ; MODIFIER silent_mutation Average:20.517; most accessible tissue: Callus, score: 75.436 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127461949 NA 1.55E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127461949 NA 1.97E-08 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127461949 1.60E-06 1.60E-06 mr1111_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127461949 3.24E-06 4.92E-07 mr1144_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127461949 NA 8.80E-07 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127461949 NA 1.03E-10 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251