\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127382510:

Variant ID: vg1127382510 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27382510
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGAGCAGTTATGACGCACCTGCAACCTAAAAAGGTCTCGTCCAGAAAAATTATTTATGCAGCAATGAAAGTTGATTTTAGTACATCGAGTTATTTACT[A/T]
CTTATTATTTCTTTATAAATGTGTATCACATCTACAAATAAATTTTGGATATGCAGCACGGTGCATATCCAAATCTCTACTATTATAAAAATTGAAGATG

Reverse complement sequence

CATCTTCAATTTTTATAATAGTAGAGATTTGGATATGCACCGTGCTGCATATCCAAAATTTATTTGTAGATGTGATACACATTTATAAAGAAATAATAAG[T/A]
AGTAAATAACTCGATGTACTAAAATCAACTTTCATTGCTGCATAAATAATTTTTCTGGACGAGACCTTTTTAGGTTGCAGGTGCGTCATAACTGCTCTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.60% 0.13% 0.00% NA
All Indica  2759 73.50% 26.30% 0.18% 0.00% NA
All Japonica  1512 81.80% 18.10% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 64.00% 35.80% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 59.80% 40.20% 0.00% 0.00% NA
Indica Intermediate  786 81.90% 17.60% 0.51% 0.00% NA
Temperate Japonica  767 67.40% 32.50% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127382510 A -> T LOC_Os11g45240.1 upstream_gene_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:49.267; most accessible tissue: Callus, score: 70.328 N N N N
vg1127382510 A -> T LOC_Os11g45250.1 downstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:49.267; most accessible tissue: Callus, score: 70.328 N N N N
vg1127382510 A -> T LOC_Os11g45250.2 downstream_gene_variant ; 1006.0bp to feature; MODIFIER silent_mutation Average:49.267; most accessible tissue: Callus, score: 70.328 N N N N
vg1127382510 A -> T LOC_Os11g45240-LOC_Os11g45250 intergenic_region ; MODIFIER silent_mutation Average:49.267; most accessible tissue: Callus, score: 70.328 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127382510 NA 5.67E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 1.50E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 3.89E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 5.74E-06 mr1208_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 1.32E-07 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 5.02E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 3.50E-06 3.50E-06 mr1424_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 6.40E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 4.78E-06 4.78E-06 mr1884_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127382510 NA 6.54E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251