\
| Variant ID: vg1127382510 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27382510 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, A: 0.04, others allele: 0.00, population size: 177. )
TGAGAGCAGTTATGACGCACCTGCAACCTAAAAAGGTCTCGTCCAGAAAAATTATTTATGCAGCAATGAAAGTTGATTTTAGTACATCGAGTTATTTACT[A/T]
CTTATTATTTCTTTATAAATGTGTATCACATCTACAAATAAATTTTGGATATGCAGCACGGTGCATATCCAAATCTCTACTATTATAAAAATTGAAGATG
CATCTTCAATTTTTATAATAGTAGAGATTTGGATATGCACCGTGCTGCATATCCAAAATTTATTTGTAGATGTGATACACATTTATAAAGAAATAATAAG[T/A]
AGTAAATAACTCGATGTACTAAAATCAACTTTCATTGCTGCATAAATAATTTTTCTGGACGAGACCTTTTTAGGTTGCAGGTGCGTCATAACTGCTCTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.20% | 21.60% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 73.50% | 26.30% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 81.80% | 18.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.00% | 35.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 59.80% | 40.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.90% | 17.60% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 67.40% | 32.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127382510 | A -> T | LOC_Os11g45240.1 | upstream_gene_variant ; 771.0bp to feature; MODIFIER | silent_mutation | Average:49.267; most accessible tissue: Callus, score: 70.328 | N | N | N | N |
| vg1127382510 | A -> T | LOC_Os11g45250.1 | downstream_gene_variant ; 1006.0bp to feature; MODIFIER | silent_mutation | Average:49.267; most accessible tissue: Callus, score: 70.328 | N | N | N | N |
| vg1127382510 | A -> T | LOC_Os11g45250.2 | downstream_gene_variant ; 1006.0bp to feature; MODIFIER | silent_mutation | Average:49.267; most accessible tissue: Callus, score: 70.328 | N | N | N | N |
| vg1127382510 | A -> T | LOC_Os11g45240-LOC_Os11g45250 | intergenic_region ; MODIFIER | silent_mutation | Average:49.267; most accessible tissue: Callus, score: 70.328 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127382510 | NA | 5.67E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 1.50E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 3.89E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 5.74E-06 | mr1208_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 1.32E-07 | mr1232_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 5.02E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | 3.50E-06 | 3.50E-06 | mr1424_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 6.40E-09 | mr1598_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | 4.78E-06 | 4.78E-06 | mr1884_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127382510 | NA | 6.54E-06 | mr1901_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |