\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127289636:

Variant ID: vg1127289636 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27289636
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCACAATTTTTTTCTAATTAGTAGGGTGATTGCTATTTGCTAATCATAAGTGGGGCCCATATCTCTCTCCTATCCTTCTTCTTCTTCCTCACGCACGCG[C/G]
CAGAGTAGAGGAACGGCGCGCGGCCGGCGCGACGACCTGAGCCAGGACGGCTCGGCGTGCAGCAGAAAAAGCGGCGGCGCTCCGCCATGGTCTCACCGCC

Reverse complement sequence

GGCGGTGAGACCATGGCGGAGCGCCGCCGCTTTTTCTGCTGCACGCCGAGCCGTCCTGGCTCAGGTCGTCGCGCCGGCCGCGCGCCGTTCCTCTACTCTG[G/C]
CGCGTGCGTGAGGAAGAAGAAGAAGGATAGGAGAGAGATATGGGCCCCACTTATGATTAGCAAATAGCAATCACCCTACTAATTAGAAAAAAATTGTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 19.30% 4.44% 30.58% NA
All Indica  2759 50.70% 16.70% 4.02% 28.52% NA
All Japonica  1512 37.00% 27.30% 4.89% 30.75% NA
Aus  269 24.20% 7.40% 8.55% 59.85% NA
Indica I  595 52.40% 36.60% 3.19% 7.73% NA
Indica II  465 55.10% 15.30% 4.73% 24.95% NA
Indica III  913 45.10% 4.40% 3.18% 47.32% NA
Indica Intermediate  786 53.30% 16.90% 5.22% 24.55% NA
Temperate Japonica  767 11.00% 46.30% 5.87% 36.90% NA
Tropical Japonica  504 69.60% 4.80% 2.98% 22.62% NA
Japonica Intermediate  241 51.90% 14.10% 5.81% 28.22% NA
VI/Aromatic  96 84.40% 4.20% 1.04% 10.42% NA
Intermediate  90 58.90% 15.60% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127289636 C -> DEL N N silent_mutation Average:67.572; most accessible tissue: Minghui63 young leaf, score: 90.449 N N N N
vg1127289636 C -> G LOC_Os11g45100.1 upstream_gene_variant ; 167.0bp to feature; MODIFIER silent_mutation Average:67.572; most accessible tissue: Minghui63 young leaf, score: 90.449 N N N N
vg1127289636 C -> G LOC_Os11g45090.1 downstream_gene_variant ; 4591.0bp to feature; MODIFIER silent_mutation Average:67.572; most accessible tissue: Minghui63 young leaf, score: 90.449 N N N N
vg1127289636 C -> G LOC_Os11g45090-LOC_Os11g45100 intergenic_region ; MODIFIER silent_mutation Average:67.572; most accessible tissue: Minghui63 young leaf, score: 90.449 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127289636 C G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127289636 NA 1.97E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 NA 4.33E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 NA 3.25E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 4.51E-06 4.50E-06 mr1424_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 NA 7.94E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 4.75E-06 4.75E-06 mr1787_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 NA 3.06E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127289636 NA 9.00E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251