\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127281448:

Variant ID: vg1127281448 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27281448
Reference Allele: CAlternative Allele: G,A,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAATTTACTTCCTTTGTTTCCTTAAGATAATCTGTAAATGCTCGTTTTGATTGCAGGCACGGTGTTTCATCAGGATCAGTCGTGTCTATTTCTGTCTGC[C/G,A,T]
CTGTGATCGCTTGAGACGAGGTCTGCTAGGAAGGAAAATCTGCTTCATCTGAATAAACACATATATACTGATATCTCCTTGTAGCAGACACTCTCCCGTC

Reverse complement sequence

GACGGGAGAGTGTCTGCTACAAGGAGATATCAGTATATATGTGTTTATTCAGATGAAGCAGATTTTCCTTCCTAGCAGACCTCGTCTCAAGCGATCACAG[G/C,T,A]
GCAGACAGAAATAGACACGACTGATCCTGATGAAACACCGTGCCTGCAATCAAAACGAGCATTTACAGATTATCTTAAGGAAACAAAGGAAGTAAATTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.80% 15.10% 9.67% 45.34% A: 11.62%; T: 0.49%
All Indica  2759 11.30% 10.30% 10.22% 54.37% A: 13.34%; T: 0.40%
All Japonica  1512 27.70% 23.60% 8.60% 29.83% A: 9.52%; T: 0.73%
Aus  269 31.20% 7.40% 14.87% 42.38% A: 4.09%
Indica I  595 10.40% 26.60% 15.97% 26.55% A: 20.34%; T: 0.17%
Indica II  465 3.70% 6.20% 4.09% 69.46% A: 16.56%
Indica III  913 18.10% 1.30% 9.75% 63.64% A: 6.13%; T: 1.10%
Indica Intermediate  786 8.80% 10.90% 10.05% 55.73% A: 14.50%
Temperate Japonica  767 21.90% 40.90% 8.08% 22.29% A: 6.39%; T: 0.39%
Tropical Japonica  504 39.50% 4.40% 8.33% 34.33% A: 12.30%; T: 1.19%
Japonica Intermediate  241 21.60% 8.70% 10.79% 44.40% A: 13.69%; T: 0.83%
VI/Aromatic  96 9.40% 35.40% 1.04% 53.12% A: 1.04%
Intermediate  90 17.80% 18.90% 4.44% 30.00% A: 27.78%; T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127281448 C -> T LOC_Os11g45080.1 upstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> T LOC_Os11g45090.1 upstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> T LOC_Os11g45080-LOC_Os11g45090 intergenic_region ; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> A LOC_Os11g45080.1 upstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> A LOC_Os11g45090.1 upstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> A LOC_Os11g45080-LOC_Os11g45090 intergenic_region ; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> G LOC_Os11g45080.1 upstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> G LOC_Os11g45090.1 upstream_gene_variant ; 784.0bp to feature; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> G LOC_Os11g45080-LOC_Os11g45090 intergenic_region ; MODIFIER silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N
vg1127281448 C -> DEL N N silent_mutation Average:85.381; most accessible tissue: Minghui63 flag leaf, score: 98.608 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127281448 C A 0.0 -0.01 0.0 0.02 0.01 0.02
vg1127281448 C G 0.02 0.01 0.01 0.01 0.01 0.01
vg1127281448 C T 0.02 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127281448 NA 2.17E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127281448 NA 1.36E-08 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127281448 6.18E-06 4.96E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127281448 2.20E-09 1.55E-17 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127281448 3.29E-10 8.60E-17 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251