\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127262549:

Variant ID: vg1127262549 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27262549
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGAAAAAGGACAATTACTAGAAGATACAGCAGAGAGATATTATTATGAGCTGATCCATCGGAACTTGCTCCAACCAGATGGTTTATATTTTGACCACA[G/T,A]
CAGCTGCAAGATGCATGATCTCTTAAGGCAACTTGCTTCTTATTTGTCAAGAGAAGAATGTTTTGTTGGAGACCCAGAGTCACTAGGGACTAATACTATG

Reverse complement sequence

CATAGTATTAGTCCCTAGTGACTCTGGGTCTCCAACAAAACATTCTTCTCTTGACAAATAAGAAGCAAGTTGCCTTAAGAGATCATGCATCTTGCAGCTG[C/A,T]
TGTGGTCAAAATATAAACCATCTGGTTGGAGCAAGTTCCGATGGATCAGCTCATAATAATATCTCTCTGCTGTATCTTCTAGTAATTGTCCTTTTTCCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.10% 10.20% 11.66% 32.14% A: 9.88%
All Indica  2759 29.80% 10.00% 13.63% 34.80% A: 11.74%
All Japonica  1512 52.60% 7.80% 8.66% 23.08% A: 7.87%
Aus  269 16.00% 4.80% 9.67% 64.31% A: 5.20%
Indica I  595 48.10% 24.20% 8.07% 15.29% A: 4.37%
Indica II  465 35.30% 4.50% 11.18% 37.42% A: 11.61%
Indica III  913 17.00% 2.60% 19.61% 43.04% A: 17.74%
Indica Intermediate  786 27.70% 11.10% 12.34% 38.42% A: 10.43%
Temperate Japonica  767 59.20% 1.30% 5.08% 27.51% A: 6.91%
Tropical Japonica  504 50.00% 17.30% 11.11% 15.08% A: 6.55%
Japonica Intermediate  241 36.90% 8.70% 14.94% 25.73% A: 13.69%
VI/Aromatic  96 15.60% 61.50% 6.25% 11.46% A: 5.21%
Intermediate  90 35.60% 16.70% 13.33% 28.89% A: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127262549 G -> T LOC_Os11g45050.1 missense_variant ; p.Ser486Ile; MODERATE nonsynonymous_codon ; S486I Average:45.871; most accessible tissue: Minghui63 flag leaf, score: 91.558 benign 0.848 TOLERATED 0.16
vg1127262549 G -> A LOC_Os11g45050.1 missense_variant ; p.Ser486Asn; MODERATE frameshift_variant Average:45.871; most accessible tissue: Minghui63 flag leaf, score: 91.558 N N N N
vg1127262549 G -> A LOC_Os11g45050.1 missense_variant ; p.Ser486Asn; MODERATE nonsynonymous_codon ; S486N Average:45.871; most accessible tissue: Minghui63 flag leaf, score: 91.558 possibly damaging 1.785 TOLERATED 0.11
vg1127262549 G -> DEL LOC_Os11g45050.1 N frameshift_variant Average:45.871; most accessible tissue: Minghui63 flag leaf, score: 91.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127262549 G A -0.08 -0.02 -0.03 -0.02 -0.02 -0.02
vg1127262549 G T 0.15 -0.01 -0.01 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127262549 NA 6.52E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 2.20E-08 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 2.12E-08 mr1257 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 5.35E-10 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 5.23E-12 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 3.83E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 9.85E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127262549 NA 9.24E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251