\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127189605:

Variant ID: vg1127189605 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27189605
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTAGATAATAAAATATAAATAATATTTTATGTGTGACTAAATATTTTCAATTTTTTTATAAATTTTTCAAATAAGACAGACGATCAAACGTTGGGTAC[G/A]
GATATCCACGGCTGCACTTATTTTGGGACGGAGGTAGTATACTGTGCGCCGCATCACCCGTCCGATCCCACCCACGGTCCCCTGTCTGCGGGGCCCACCG

Reverse complement sequence

CGGTGGGCCCCGCAGACAGGGGACCGTGGGTGGGATCGGACGGGTGATGCGGCGCACAGTATACTACCTCCGTCCCAAAATAAGTGCAGCCGTGGATATC[C/T]
GTACCCAACGTTTGATCGTCTGTCTTATTTGAAAAATTTATAAAAAAATTGAAAATATTTAGTCACACATAAAATATTATTTATATTTTATTATCTAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 3.70% 0.08% 11.85% NA
All Indica  2759 82.50% 3.30% 0.14% 14.10% NA
All Japonica  1512 87.80% 4.40% 0.00% 7.80% NA
Aus  269 80.70% 6.70% 0.00% 12.64% NA
Indica I  595 75.10% 1.50% 0.17% 23.19% NA
Indica II  465 80.00% 0.40% 0.43% 19.14% NA
Indica III  913 84.20% 7.30% 0.11% 8.32% NA
Indica Intermediate  786 87.50% 1.50% 0.00% 10.94% NA
Temperate Japonica  767 89.00% 8.00% 0.00% 3.00% NA
Tropical Japonica  504 82.10% 0.40% 0.00% 17.46% NA
Japonica Intermediate  241 95.40% 1.70% 0.00% 2.90% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 78.90% 2.20% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127189605 G -> A LOC_Os11g44920.1 upstream_gene_variant ; 1406.0bp to feature; MODIFIER silent_mutation Average:97.413; most accessible tissue: Zhenshan97 panicle, score: 99.904 N N N N
vg1127189605 G -> A LOC_Os11g44910-LOC_Os11g44920 intergenic_region ; MODIFIER silent_mutation Average:97.413; most accessible tissue: Zhenshan97 panicle, score: 99.904 N N N N
vg1127189605 G -> DEL N N silent_mutation Average:97.413; most accessible tissue: Zhenshan97 panicle, score: 99.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127189605 G A 0.0 0.02 0.01 0.02 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127189605 1.24E-06 1.24E-06 mr1644 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127189605 2.47E-11 2.47E-11 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251