\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127158886:

Variant ID: vg1127158886 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27158886
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATACATCATACAACAGAGTTTACTCAACTCCAACAATTGTAAATTGTATACATCTGAAGAGAAATATTCCCTTGGTGATCAACTGATCTTTCCCAAT[A/C]
CTCATGCTTTTCTGGCCCCTATTCTATCTATGTACAGTACCAAAAATTGATTGAATGAATGATAAAACAATGAGCCAGCAACCTTTGAAGAGGACTGACA

Reverse complement sequence

TGTCAGTCCTCTTCAAAGGTTGCTGGCTCATTGTTTTATCATTCATTCAATCAATTTTTGGTACTGTACATAGATAGAATAGGGGCCAGAAAAGCATGAG[T/G]
ATTGGGAAAGATCAGTTGATCACCAAGGGAATATTTCTCTTCAGATGTATACAATTTACAATTGTTGGAGTTGAGTAAACTCTGTTGTATGATGTATTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 9.80% 0.04% 0.00% NA
All Indica  2759 86.70% 13.30% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 97.40% 1.90% 0.74% 0.00% NA
Indica I  595 75.30% 24.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 89.80% 10.20% 0.00% 0.00% NA
Indica Intermediate  786 84.90% 15.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127158886 A -> C LOC_Os11g44870.1 downstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:61.237; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg1127158886 A -> C LOC_Os11g44870.2 downstream_gene_variant ; 1173.0bp to feature; MODIFIER silent_mutation Average:61.237; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N
vg1127158886 A -> C LOC_Os11g44880.1 intron_variant ; MODIFIER silent_mutation Average:61.237; most accessible tissue: Zhenshan97 root, score: 89.337 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127158886 A C 0.02 0.0 0.0 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127158886 NA 5.68E-06 mr1206 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127158886 2.79E-07 2.19E-08 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127158886 2.79E-07 2.19E-08 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127158886 NA 2.50E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127158886 8.40E-07 6.07E-07 mr1775 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127158886 2.30E-06 3.60E-07 mr1820 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127158886 NA 9.15E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251