Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127100023:

Variant ID: vg1127100023 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27100023
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.30, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAGCAATTCTTTCTTCTTGAGTTGTTTCATTACCTCCTGCTGCTGTGGATGTCTTGGCCATCTCTGCCCACTGCTTGTCAAGTGTTTCCGTTGCTCTT[A/G]
CCAAGTCACTTTCTTCCACTGCCTTTTCCCACTCTCTCTCGAGTGCAGCTGTCGCGCTTGCAAAAGCTCCTGTATAGCGTACTGGCACAGTCTTCTGTCG

Reverse complement sequence

CGACAGAAGACTGTGCCAGTACGCTATACAGGAGCTTTTGCAAGCGCGACAGCTGCACTCGAGAGAGAGTGGGAAAAGGCAGTGGAAGAAAGTGACTTGG[T/C]
AAGAGCAACGGAAACACTTGACAAGCAGTGGGCAGAGATGGCCAAGACATCCACAGCAGCAGGAGGTAATGAAACAACTCAAGAAGAAAGAATTGCTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.60%	5.60%	12.87%	38.87%	NA
All Indica	2759	23.80%	9.00%	18.30%	48.89%	NA
All Japonica	1512	70.50%	0.10%	2.31%	27.05%	NA
Aus	269	79.90%	4.50%	14.13%	1.49%	NA
Indica I	595	29.10%	21.80%	9.08%	40.00%	NA
Indica II	465	26.20%	1.70%	13.33%	58.71%	NA
Indica III	913	15.70%	6.50%	25.96%	51.92%	NA
Indica Intermediate	786	28.00%	6.40%	19.34%	46.31%	NA
Temperate Japonica	767	77.60%	0.00%	1.04%	21.38%	NA
Tropical Japonica	504	60.30%	0.00%	2.58%	37.10%	NA
Japonica Intermediate	241	69.30%	0.80%	5.81%	24.07%	NA
VI/Aromatic	96	24.00%	2.10%	17.71%	56.25%	NA
Intermediate	90	58.90%	3.30%	14.44%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127100023	A -> DEL	N	N	silent_mutation	Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1127100023	A -> G	LOC_Os11g44770.1	upstream_gene_variant ; 38.0bp to feature; MODIFIER	silent_mutation	Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1127100023	A -> G	LOC_Os11g44780.1	downstream_gene_variant ; 1308.0bp to feature; MODIFIER	silent_mutation	Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N
vg1127100023	A -> G	LOC_Os11g44770-LOC_Os11g44780	intergenic_region ; MODIFIER	silent_mutation	Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127100023	NA	2.30E-06	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	NA	1.47E-09	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	NA	1.65E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	NA	3.87E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	8.82E-06	1.38E-07	mr1407_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	NA	1.34E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	NA	1.74E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023	NA	7.44E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251