\
| Variant ID: vg1127100023 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27100023 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.30, others allele: 0.00, population size: 59. )
ACCAGCAATTCTTTCTTCTTGAGTTGTTTCATTACCTCCTGCTGCTGTGGATGTCTTGGCCATCTCTGCCCACTGCTTGTCAAGTGTTTCCGTTGCTCTT[A/G]
CCAAGTCACTTTCTTCCACTGCCTTTTCCCACTCTCTCTCGAGTGCAGCTGTCGCGCTTGCAAAAGCTCCTGTATAGCGTACTGGCACAGTCTTCTGTCG
CGACAGAAGACTGTGCCAGTACGCTATACAGGAGCTTTTGCAAGCGCGACAGCTGCACTCGAGAGAGAGTGGGAAAAGGCAGTGGAAGAAAGTGACTTGG[T/C]
AAGAGCAACGGAAACACTTGACAAGCAGTGGGCAGAGATGGCCAAGACATCCACAGCAGCAGGAGGTAATGAAACAACTCAAGAAGAAAGAATTGCTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.60% | 5.60% | 12.87% | 38.87% | NA |
| All Indica | 2759 | 23.80% | 9.00% | 18.30% | 48.89% | NA |
| All Japonica | 1512 | 70.50% | 0.10% | 2.31% | 27.05% | NA |
| Aus | 269 | 79.90% | 4.50% | 14.13% | 1.49% | NA |
| Indica I | 595 | 29.10% | 21.80% | 9.08% | 40.00% | NA |
| Indica II | 465 | 26.20% | 1.70% | 13.33% | 58.71% | NA |
| Indica III | 913 | 15.70% | 6.50% | 25.96% | 51.92% | NA |
| Indica Intermediate | 786 | 28.00% | 6.40% | 19.34% | 46.31% | NA |
| Temperate Japonica | 767 | 77.60% | 0.00% | 1.04% | 21.38% | NA |
| Tropical Japonica | 504 | 60.30% | 0.00% | 2.58% | 37.10% | NA |
| Japonica Intermediate | 241 | 69.30% | 0.80% | 5.81% | 24.07% | NA |
| VI/Aromatic | 96 | 24.00% | 2.10% | 17.71% | 56.25% | NA |
| Intermediate | 90 | 58.90% | 3.30% | 14.44% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127100023 | A -> DEL | N | N | silent_mutation | Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1127100023 | A -> G | LOC_Os11g44770.1 | upstream_gene_variant ; 38.0bp to feature; MODIFIER | silent_mutation | Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1127100023 | A -> G | LOC_Os11g44780.1 | downstream_gene_variant ; 1308.0bp to feature; MODIFIER | silent_mutation | Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| vg1127100023 | A -> G | LOC_Os11g44770-LOC_Os11g44780 | intergenic_region ; MODIFIER | silent_mutation | Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127100023 | NA | 2.30E-06 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | NA | 1.47E-09 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | NA | 1.65E-07 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | NA | 3.87E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | 8.82E-06 | 1.38E-07 | mr1407_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | NA | 1.34E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | NA | 1.74E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127100023 | NA | 7.44E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |