\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127100023:

Variant ID: vg1127100023 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27100023
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.71, G: 0.30, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGCAATTCTTTCTTCTTGAGTTGTTTCATTACCTCCTGCTGCTGTGGATGTCTTGGCCATCTCTGCCCACTGCTTGTCAAGTGTTTCCGTTGCTCTT[A/G]
CCAAGTCACTTTCTTCCACTGCCTTTTCCCACTCTCTCTCGAGTGCAGCTGTCGCGCTTGCAAAAGCTCCTGTATAGCGTACTGGCACAGTCTTCTGTCG

Reverse complement sequence

CGACAGAAGACTGTGCCAGTACGCTATACAGGAGCTTTTGCAAGCGCGACAGCTGCACTCGAGAGAGAGTGGGAAAAGGCAGTGGAAGAAAGTGACTTGG[T/C]
AAGAGCAACGGAAACACTTGACAAGCAGTGGGCAGAGATGGCCAAGACATCCACAGCAGCAGGAGGTAATGAAACAACTCAAGAAGAAAGAATTGCTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 5.60% 12.87% 38.87% NA
All Indica  2759 23.80% 9.00% 18.30% 48.89% NA
All Japonica  1512 70.50% 0.10% 2.31% 27.05% NA
Aus  269 79.90% 4.50% 14.13% 1.49% NA
Indica I  595 29.10% 21.80% 9.08% 40.00% NA
Indica II  465 26.20% 1.70% 13.33% 58.71% NA
Indica III  913 15.70% 6.50% 25.96% 51.92% NA
Indica Intermediate  786 28.00% 6.40% 19.34% 46.31% NA
Temperate Japonica  767 77.60% 0.00% 1.04% 21.38% NA
Tropical Japonica  504 60.30% 0.00% 2.58% 37.10% NA
Japonica Intermediate  241 69.30% 0.80% 5.81% 24.07% NA
VI/Aromatic  96 24.00% 2.10% 17.71% 56.25% NA
Intermediate  90 58.90% 3.30% 14.44% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127100023 A -> DEL N N silent_mutation Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1127100023 A -> G LOC_Os11g44770.1 upstream_gene_variant ; 38.0bp to feature; MODIFIER silent_mutation Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1127100023 A -> G LOC_Os11g44780.1 downstream_gene_variant ; 1308.0bp to feature; MODIFIER silent_mutation Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N
vg1127100023 A -> G LOC_Os11g44770-LOC_Os11g44780 intergenic_region ; MODIFIER silent_mutation Average:21.145; most accessible tissue: Minghui63 flag leaf, score: 46.761 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127100023 NA 2.30E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 NA 1.47E-09 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 NA 1.65E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 NA 3.87E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 8.82E-06 1.38E-07 mr1407_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 NA 1.34E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 NA 1.74E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127100023 NA 7.44E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251