Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127029126:

Variant ID: vg1127029126 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27029126
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTGGACTTGAAATTTTGCAAGATTTGAATTCCTTTCATAGTTTGTGACATTTCATATTATAAGTTATTTTGACTTATTTTCTAGTTAAGTTATTTTA[G/A]
GTTTGGCCAAATCTTATATACAAATATAGTAAAATATTCAAACTAAAAAATAATGACTAGGAAAAAAAAGTAAAAACGACTTACAATACGTGGAGAGAGT

Reverse complement sequence

ACTCTCTCCACGTATTGTAAGTCGTTTTTACTTTTTTTTCCTAGTCATTATTTTTTAGTTTGAATATTTTACTATATTTGTATATAAGATTTGGCCAAAC[C/T]
TAAAATAACTTAACTAGAAAATAAGTCAAAATAACTTATAATATGAAATGTCACAAACTATGAAAGGAATTCAAATCTTGCAAAATTTCAAGTCCAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.30%	24.90%	1.10%	5.65%	NA
All Indica	2759	52.60%	38.40%	1.45%	7.58%	NA
All Japonica	1512	91.60%	5.20%	0.33%	2.91%	NA
Aus	269	90.30%	5.20%	1.49%	2.97%	NA
Indica I	595	60.20%	38.50%	0.34%	1.01%	NA
Indica II	465	35.50%	63.40%	0.65%	0.43%	NA
Indica III	913	52.90%	28.50%	2.85%	15.77%	NA
Indica Intermediate	786	56.60%	35.00%	1.15%	7.25%	NA
Temperate Japonica	767	91.00%	6.40%	0.13%	2.48%	NA
Tropical Japonica	504	93.80%	4.20%	0.79%	1.19%	NA
Japonica Intermediate	241	88.80%	3.30%	0.00%	7.88%	NA
VI/Aromatic	96	84.40%	8.30%	2.08%	5.21%	NA
Intermediate	90	77.80%	20.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127029126	G -> A	LOC_Os11g44700.1	upstream_gene_variant ; 719.0bp to feature; MODIFIER	silent_mutation	Average:26.998; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg1127029126	G -> A	LOC_Os11g44690.1	downstream_gene_variant ; 1537.0bp to feature; MODIFIER	silent_mutation	Average:26.998; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg1127029126	G -> A	LOC_Os11g44690-LOC_Os11g44700	intergenic_region ; MODIFIER	silent_mutation	Average:26.998; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg1127029126	G -> DEL	N	N	silent_mutation	Average:26.998; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127029126	7.73E-06	NA	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	1.08E-09	mr1122	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	5.85E-06	mr1227	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	1.44E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	4.13E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	5.77E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	4.04E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127029126	NA	2.89E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251