\
| Variant ID: vg1127029126 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27029126 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 86. )
ATTCTGGACTTGAAATTTTGCAAGATTTGAATTCCTTTCATAGTTTGTGACATTTCATATTATAAGTTATTTTGACTTATTTTCTAGTTAAGTTATTTTA[G/A]
GTTTGGCCAAATCTTATATACAAATATAGTAAAATATTCAAACTAAAAAATAATGACTAGGAAAAAAAAGTAAAAACGACTTACAATACGTGGAGAGAGT
ACTCTCTCCACGTATTGTAAGTCGTTTTTACTTTTTTTTCCTAGTCATTATTTTTTAGTTTGAATATTTTACTATATTTGTATATAAGATTTGGCCAAAC[C/T]
TAAAATAACTTAACTAGAAAATAAGTCAAAATAACTTATAATATGAAATGTCACAAACTATGAAAGGAATTCAAATCTTGCAAAATTTCAAGTCCAGAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 24.90% | 1.10% | 5.65% | NA |
| All Indica | 2759 | 52.60% | 38.40% | 1.45% | 7.58% | NA |
| All Japonica | 1512 | 91.60% | 5.20% | 0.33% | 2.91% | NA |
| Aus | 269 | 90.30% | 5.20% | 1.49% | 2.97% | NA |
| Indica I | 595 | 60.20% | 38.50% | 0.34% | 1.01% | NA |
| Indica II | 465 | 35.50% | 63.40% | 0.65% | 0.43% | NA |
| Indica III | 913 | 52.90% | 28.50% | 2.85% | 15.77% | NA |
| Indica Intermediate | 786 | 56.60% | 35.00% | 1.15% | 7.25% | NA |
| Temperate Japonica | 767 | 91.00% | 6.40% | 0.13% | 2.48% | NA |
| Tropical Japonica | 504 | 93.80% | 4.20% | 0.79% | 1.19% | NA |
| Japonica Intermediate | 241 | 88.80% | 3.30% | 0.00% | 7.88% | NA |
| VI/Aromatic | 96 | 84.40% | 8.30% | 2.08% | 5.21% | NA |
| Intermediate | 90 | 77.80% | 20.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127029126 | G -> A | LOC_Os11g44700.1 | upstream_gene_variant ; 719.0bp to feature; MODIFIER | silent_mutation | Average:26.998; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg1127029126 | G -> A | LOC_Os11g44690.1 | downstream_gene_variant ; 1537.0bp to feature; MODIFIER | silent_mutation | Average:26.998; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg1127029126 | G -> A | LOC_Os11g44690-LOC_Os11g44700 | intergenic_region ; MODIFIER | silent_mutation | Average:26.998; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| vg1127029126 | G -> DEL | N | N | silent_mutation | Average:26.998; most accessible tissue: Minghui63 root, score: 40.262 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127029126 | 7.73E-06 | NA | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 1.08E-09 | mr1122 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 5.85E-06 | mr1227 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 1.44E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 4.13E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 5.77E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 4.04E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127029126 | NA | 2.89E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |