\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127020065:

Variant ID: vg1127020065 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27020065
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAACTATCCGGTGATGACGCTCAGTGATGATGCTTACATTCCCTTCATTGACACAGCACAAAATCCTCCAGATTTGCATGTTACATTTCAAGGTAAG[A/G]
CATTGGTTTTGTTCTCTTGTCTTTCATCAGACTCAACTACTGACGATTTGTTTATTTGGATTTGACAGTTCAGGGTATTGCAGGAGCTGAGATTTATCAT

Reverse complement sequence

ATGATAAATCTCAGCTCCTGCAATACCCTGAACTGTCAAATCCAAATAAACAAATCGTCAGTAGTTGAGTCTGATGAAAGACAAGAGAACAAAACCAATG[T/C]
CTTACCTTGAAATGTAACATGCAAATCTGGAGGATTTTGTGCTGTGTCAATGAAGGGAATGTAAGCATCATCACTGAGCGTCATCACCGGATAGTTATTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 37.30% 0.44% 2.88% NA
All Indica  2759 59.70% 35.10% 0.72% 4.42% NA
All Japonica  1512 58.50% 40.60% 0.07% 0.79% NA
Aus  269 73.60% 26.40% 0.00% 0.00% NA
Indica I  595 80.50% 16.50% 0.67% 2.35% NA
Indica II  465 34.60% 60.60% 2.37% 2.37% NA
Indica III  913 62.10% 30.00% 0.22% 7.67% NA
Indica Intermediate  786 56.10% 40.10% 0.38% 3.44% NA
Temperate Japonica  767 43.40% 54.90% 0.13% 1.56% NA
Tropical Japonica  504 75.20% 24.80% 0.00% 0.00% NA
Japonica Intermediate  241 71.80% 28.20% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127020065 A -> DEL N N silent_mutation Average:56.668; most accessible tissue: Zhenshan97 root, score: 85.796 N N N N
vg1127020065 A -> G LOC_Os11g44680.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:56.668; most accessible tissue: Zhenshan97 root, score: 85.796 N N N N
vg1127020065 A -> G LOC_Os11g44690.1 upstream_gene_variant ; 4365.0bp to feature; MODIFIER silent_mutation Average:56.668; most accessible tissue: Zhenshan97 root, score: 85.796 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127020065 A G -0.01 0.0 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127020065 NA 1.82E-10 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1127020065 NA 6.37E-12 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1127020065 NA 2.04E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 3.24E-08 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 4.54E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 9.00E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 8.48E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 1.46E-06 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 1.25E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 7.55E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 1.47E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 1.03E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 5.78E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 2.78E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 3.89E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 2.16E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127020065 NA 9.94E-07 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251