\
| Variant ID: vg1126992329 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26992329 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCAAGCTCGCCGAGTTGTACATGACCAGGATAGTATGTCTTCATGGTGTGCCTAAGAGAATTATATCCGATTGAGGCACGCAGTTTACTTCGCATTTCT[G/A]
GGAGAAAGTACATGAAGCCCTAGGAAGTTACCTTGCTTTTAGCACAGCTTATCATCCACAGACAGATGGCCAGACAGAGAGAACAAACCAGGTCTTGGAG
CTCCAAGACCTGGTTTGTTCTCTCTGTCTGGCCATCTGTCTGTGGATGATAAGCTGTGCTAAAAGCAAGGTAACTTCCTAGGGCTTCATGTACTTTCTCC[C/T]
AGAAATGCGAAGTAAACTGCGTGCCTCAATCGGATATAATTCTCTTAGGCACACCATGAAGACATACTATCCTGGTCATGTACAACTCGGCGAGCTTGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 1.20% | 3.64% | 20.14% | NA |
| All Indica | 2759 | 88.30% | 2.10% | 4.89% | 4.71% | NA |
| All Japonica | 1512 | 47.60% | 0.00% | 1.46% | 50.99% | NA |
| Aus | 269 | 93.30% | 0.00% | 2.97% | 3.72% | NA |
| Indica I | 595 | 71.10% | 6.60% | 13.45% | 8.91% | NA |
| Indica II | 465 | 94.80% | 0.40% | 2.80% | 1.94% | NA |
| Indica III | 913 | 94.90% | 0.00% | 1.10% | 4.05% | NA |
| Indica Intermediate | 786 | 89.70% | 2.30% | 4.07% | 3.94% | NA |
| Temperate Japonica | 767 | 61.30% | 0.00% | 1.43% | 37.29% | NA |
| Tropical Japonica | 504 | 32.30% | 0.00% | 1.19% | 66.47% | NA |
| Japonica Intermediate | 241 | 35.70% | 0.00% | 2.07% | 62.24% | NA |
| VI/Aromatic | 96 | 68.80% | 0.00% | 3.12% | 28.12% | NA |
| Intermediate | 90 | 80.00% | 0.00% | 4.44% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126992329 | G -> A | LOC_Os11g44640.1 | downstream_gene_variant ; 26.0bp to feature; MODIFIER | silent_mutation | Average:15.348; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| vg1126992329 | G -> A | LOC_Os11g44640-LOC_Os11g44650 | intergenic_region ; MODIFIER | silent_mutation | Average:15.348; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| vg1126992329 | G -> DEL | N | N | silent_mutation | Average:15.348; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126992329 | NA | 3.62E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 1.49E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 9.82E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 2.26E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 9.09E-06 | mr1749 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 2.10E-06 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 7.35E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | 7.35E-06 | NA | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | 1.03E-06 | 6.27E-08 | mr1844 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126992329 | NA | 5.46E-06 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |