\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126992329:

Variant ID: vg1126992329 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26992329
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCAAGCTCGCCGAGTTGTACATGACCAGGATAGTATGTCTTCATGGTGTGCCTAAGAGAATTATATCCGATTGAGGCACGCAGTTTACTTCGCATTTCT[G/A]
GGAGAAAGTACATGAAGCCCTAGGAAGTTACCTTGCTTTTAGCACAGCTTATCATCCACAGACAGATGGCCAGACAGAGAGAACAAACCAGGTCTTGGAG

Reverse complement sequence

CTCCAAGACCTGGTTTGTTCTCTCTGTCTGGCCATCTGTCTGTGGATGATAAGCTGTGCTAAAAGCAAGGTAACTTCCTAGGGCTTCATGTACTTTCTCC[C/T]
AGAAATGCGAAGTAAACTGCGTGCCTCAATCGGATATAATTCTCTTAGGCACACCATGAAGACATACTATCCTGGTCATGTACAACTCGGCGAGCTTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 1.20% 3.64% 20.14% NA
All Indica  2759 88.30% 2.10% 4.89% 4.71% NA
All Japonica  1512 47.60% 0.00% 1.46% 50.99% NA
Aus  269 93.30% 0.00% 2.97% 3.72% NA
Indica I  595 71.10% 6.60% 13.45% 8.91% NA
Indica II  465 94.80% 0.40% 2.80% 1.94% NA
Indica III  913 94.90% 0.00% 1.10% 4.05% NA
Indica Intermediate  786 89.70% 2.30% 4.07% 3.94% NA
Temperate Japonica  767 61.30% 0.00% 1.43% 37.29% NA
Tropical Japonica  504 32.30% 0.00% 1.19% 66.47% NA
Japonica Intermediate  241 35.70% 0.00% 2.07% 62.24% NA
VI/Aromatic  96 68.80% 0.00% 3.12% 28.12% NA
Intermediate  90 80.00% 0.00% 4.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126992329 G -> A LOC_Os11g44640.1 downstream_gene_variant ; 26.0bp to feature; MODIFIER silent_mutation Average:15.348; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg1126992329 G -> A LOC_Os11g44640-LOC_Os11g44650 intergenic_region ; MODIFIER silent_mutation Average:15.348; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N
vg1126992329 G -> DEL N N silent_mutation Average:15.348; most accessible tissue: Zhenshan97 flag leaf, score: 22.512 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126992329 NA 3.62E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 1.49E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 9.82E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 2.26E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 9.09E-06 mr1749 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 2.10E-06 mr1816 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 7.35E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 7.35E-06 NA mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 1.03E-06 6.27E-08 mr1844 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126992329 NA 5.46E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251