\
| Variant ID: vg1126984434 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26984434 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.38, others allele: 0.00, population size: 99. )
TCTATATACTACCAGCACAAAAATACTTCCGCATAGGAAAACTTGTCCTCTTTGTAATATATATGGATAATTTTATCATATTTGAGAAGGTATTGAGAGG[C/T]
ATCATATTTTCTAGTGTAAAACTTAATACCAAAATTTTTAGCGTAAAATCTTAGTATCAGCAGGCACTTTCTTAAAAACTGTAAAATTTTTCAATATATA
TATATATTGAAAAATTTTACAGTTTTTAAGAAAGTGCCTGCTGATACTAAGATTTTACGCTAAAAATTTTGGTATTAAGTTTTACACTAGAAAATATGAT[G/A]
CCTCTCAATACCTTCTCAAATATGATAAAATTATCCATATATATTACAAAGAGGACAAGTTTTCCTATGCGGAAGTATTTTTGTGCTGGTAGTATATAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 30.00% | 0.28% | 2.18% | NA |
| All Indica | 2759 | 71.10% | 25.40% | 0.25% | 3.19% | NA |
| All Japonica | 1512 | 58.00% | 41.40% | 0.13% | 0.46% | NA |
| Aus | 269 | 78.80% | 17.80% | 0.74% | 2.60% | NA |
| Indica I | 595 | 91.40% | 7.60% | 0.17% | 0.84% | NA |
| Indica II | 465 | 38.50% | 60.60% | 0.86% | 0.00% | NA |
| Indica III | 913 | 79.30% | 15.90% | 0.00% | 4.82% | NA |
| Indica Intermediate | 786 | 65.60% | 29.10% | 0.25% | 4.96% | NA |
| Temperate Japonica | 767 | 45.50% | 54.20% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 71.40% | 28.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 69.70% | 28.60% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 32.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126984434 | C -> T | LOC_Os11g44630.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.601; most accessible tissue: Callus, score: 75.786 | N | N | N | N |
| vg1126984434 | C -> DEL | N | N | silent_mutation | Average:29.601; most accessible tissue: Callus, score: 75.786 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126984434 | NA | 3.25E-13 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1126984434 | NA | 3.63E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 2.46E-10 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 1.37E-09 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 2.44E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 3.16E-11 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 1.17E-06 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 1.48E-07 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 4.00E-13 | mr1380_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 8.95E-10 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 1.97E-12 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 2.47E-09 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 1.76E-09 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 8.25E-09 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 7.11E-10 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 2.37E-08 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 5.49E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 5.76E-11 | mr1996_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126984434 | NA | 6.34E-09 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |