Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126962405:

Variant ID: vg1126962405 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26962405
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CGGAAGGCTGTATTCGCCGGCATTCCGCCGTACACCCTTCTCCGGCGCCCAAGTTAGAATCAGTCTTCACTTTACGAAGTGAGCTTAATTGGTTACGTTC[C/T]
AAGCGGTGGAACCAGCCCACCAAAGTGCTCGTATTTACGGTTAATAATTCTTTCAGTGATAGGCGATGTACCCGTCGCAAGACGTGTTGATTTATTGGAA

Reverse complement sequence

TTCCAATAAATCAACACGTCTTGCGACGGGTACATCGCCTATCACTGAAAGAATTATTAACCGTAAATACGAGCACTTTGGTGGGCTGGTTCCACCGCTT[G/A]
GAACGTAACCAATTAAGCTCACTTCGTAAAGTGAAGACTGATTCTAACTTGGGCGCCGGAGAAGGGTGTACGGCGGAATGCCGGCGAATACAGCCTTCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	15.50%	0.55%	11.64%	NA
All Indica	2759	59.60%	20.80%	0.87%	18.77%	NA
All Japonica	1512	95.10%	4.70%	0.00%	0.20%	NA
Aus	269	85.10%	6.30%	0.37%	8.18%	NA
Indica I	595	48.10%	10.10%	2.86%	38.99%	NA
Indica II	465	31.80%	58.10%	0.86%	9.25%	NA
Indica III	913	80.70%	5.90%	0.00%	13.36%	NA
Indica Intermediate	786	60.10%	24.20%	0.38%	15.39%	NA
Temperate Japonica	767	99.00%	0.90%	0.00%	0.13%	NA
Tropical Japonica	504	96.40%	3.40%	0.00%	0.20%	NA
Japonica Intermediate	241	80.10%	19.50%	0.00%	0.41%	NA
VI/Aromatic	96	39.60%	57.30%	1.04%	2.08%	NA
Intermediate	90	77.80%	16.70%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126962405	C -> T	LOC_Os11g44600.1	upstream_gene_variant ; 4988.0bp to feature; MODIFIER	silent_mutation	Average:50.459; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg1126962405	C -> T	LOC_Os11g44590.1	intron_variant ; MODIFIER	silent_mutation	Average:50.459; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg1126962405	C -> DEL	N	N	silent_mutation	Average:50.459; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126962405	NA	2.68E-07	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	7.53E-06	mr1377	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	3.30E-06	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	8.12E-08	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	2.01E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	2.50E-06	NA	mr1533_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	2.48E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	1.04E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	2.04E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126962405	NA	2.70E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251