\
| Variant ID: vg1126962405 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26962405 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )
CGGAAGGCTGTATTCGCCGGCATTCCGCCGTACACCCTTCTCCGGCGCCCAAGTTAGAATCAGTCTTCACTTTACGAAGTGAGCTTAATTGGTTACGTTC[C/T]
AAGCGGTGGAACCAGCCCACCAAAGTGCTCGTATTTACGGTTAATAATTCTTTCAGTGATAGGCGATGTACCCGTCGCAAGACGTGTTGATTTATTGGAA
TTCCAATAAATCAACACGTCTTGCGACGGGTACATCGCCTATCACTGAAAGAATTATTAACCGTAAATACGAGCACTTTGGTGGGCTGGTTCCACCGCTT[G/A]
GAACGTAACCAATTAAGCTCACTTCGTAAAGTGAAGACTGATTCTAACTTGGGCGCCGGAGAAGGGTGTACGGCGGAATGCCGGCGAATACAGCCTTCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.30% | 15.50% | 0.55% | 11.64% | NA |
| All Indica | 2759 | 59.60% | 20.80% | 0.87% | 18.77% | NA |
| All Japonica | 1512 | 95.10% | 4.70% | 0.00% | 0.20% | NA |
| Aus | 269 | 85.10% | 6.30% | 0.37% | 8.18% | NA |
| Indica I | 595 | 48.10% | 10.10% | 2.86% | 38.99% | NA |
| Indica II | 465 | 31.80% | 58.10% | 0.86% | 9.25% | NA |
| Indica III | 913 | 80.70% | 5.90% | 0.00% | 13.36% | NA |
| Indica Intermediate | 786 | 60.10% | 24.20% | 0.38% | 15.39% | NA |
| Temperate Japonica | 767 | 99.00% | 0.90% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 96.40% | 3.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 39.60% | 57.30% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 77.80% | 16.70% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126962405 | C -> T | LOC_Os11g44600.1 | upstream_gene_variant ; 4988.0bp to feature; MODIFIER | silent_mutation | Average:50.459; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1126962405 | C -> T | LOC_Os11g44590.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.459; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1126962405 | C -> DEL | N | N | silent_mutation | Average:50.459; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126962405 | NA | 2.68E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 7.53E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 3.30E-06 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 8.12E-08 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 2.01E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | 2.50E-06 | NA | mr1533_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 2.48E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 1.04E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 2.04E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126962405 | NA | 2.70E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |