\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126950755:

Variant ID: vg1126950755 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26950755
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.14, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGACCGACATGGCACCTGTTATAGCCTCCGACTCCGACAAAGATAAGTTCACCATGAGGTTTGGCACCGCTACACGTGGCAATACAGGAGTGACTAAC[G/A]
TGGCACCGGTTGTAGCCTCCAACAGGAACAAGTTCACCGTCAGGCCCGATGCCGCTACACGTGGCAATGCAAGAGTAACCGACGTAGCACCTTCTGCAGC

Reverse complement sequence

GCTGCAGAAGGTGCTACGTCGGTTACTCTTGCATTGCCACGTGTAGCGGCATCGGGCCTGACGGTGAACTTGTTCCTGTTGGAGGCTACAACCGGTGCCA[C/T]
GTTAGTCACTCCTGTATTGCCACGTGTAGCGGTGCCAAACCTCATGGTGAACTTATCTTTGTCGGAGTCGGAGGCTATAACAGGTGCCATGTCGGTCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 25.60% 0.99% 11.26% NA
All Indica  2759 66.40% 14.10% 1.23% 18.19% NA
All Japonica  1512 56.00% 43.50% 0.46% 0.13% NA
Aus  269 44.60% 46.50% 0.74% 8.18% NA
Indica I  595 30.10% 26.10% 1.51% 42.35% NA
Indica II  465 69.50% 21.70% 0.43% 8.39% NA
Indica III  913 85.80% 1.50% 0.99% 11.72% NA
Indica Intermediate  786 69.70% 15.30% 1.78% 13.23% NA
Temperate Japonica  767 70.00% 29.50% 0.52% 0.00% NA
Tropical Japonica  504 39.10% 60.30% 0.60% 0.00% NA
Japonica Intermediate  241 46.50% 52.70% 0.00% 0.83% NA
VI/Aromatic  96 91.70% 5.20% 2.08% 1.04% NA
Intermediate  90 55.60% 36.70% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126950755 G -> A LOC_Os11g44570.1 missense_variant ; p.Val267Met; MODERATE nonsynonymous_codon ; V267M Average:54.285; most accessible tissue: Callus, score: 88.297 unknown unknown TOLERATED 0.12
vg1126950755 G -> DEL LOC_Os11g44570.1 N frameshift_variant Average:54.285; most accessible tissue: Callus, score: 88.297 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126950755 G A 0.02 -0.01 -0.01 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126950755 NA 7.64E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126950755 NA 8.25E-07 mr1637 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126950755 NA 4.58E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126950755 NA 3.29E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126950755 2.32E-06 NA mr1902 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126950755 NA 1.55E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126950755 NA 5.20E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251