Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126936113:

Variant ID: vg1126936113 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26936113
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TACCTCCAAATTCCAATGTAAAAATAGCTCTGGTACGATACGATGCAAGTTAGTTGCTGGATATATGAACGTATATTATAGTGTACAATTTTTTAGATAA[T/C]
GAAAGTTTATAAAACCTGGTTTCTACATCAACGGGGTTATTATTGTGTACATACACAATGTAATGATGCTTATCTGTTTATTATCTTGTTTTCAGAAAAA

Reverse complement sequence

TTTTTCTGAAAACAAGATAATAAACAGATAAGCATCATTACATTGTGTATGTACACAATAATAACCCCGTTGATGTAGAAACCAGGTTTTATAAACTTTC[A/G]
TTATCTAAAAAATTGTACACTATAATATACGTTCATATATCCAGCAACTAACTTGCATCGTATCGTACCAGAGCTATTTTTACATTGGAATTTGGAGGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 25.50% 0.55% 21.05% NA
All Indica  2759 55.40% 14.50% 0.62% 29.50% NA
All Japonica  1512 48.70% 42.80% 0.53% 8.00% NA
Aus  269 37.50% 45.70% 0.00% 16.73% NA
Indica I  595 24.00% 24.50% 1.01% 50.42% NA
Indica II  465 66.70% 21.10% 0.43% 11.83% NA
Indica III  913 67.50% 1.60% 0.55% 30.34% NA
Indica Intermediate  786 58.40% 17.90% 0.51% 23.16% NA
Temperate Japonica  767 62.60% 27.60% 0.91% 8.87% NA
Tropical Japonica  504 33.50% 61.10% 0.20% 5.16% NA
Japonica Intermediate  241 36.10% 52.70% 0.00% 11.20% NA
VI/Aromatic  96 90.60% 5.20% 1.04% 3.12% NA
Intermediate  90 51.10% 35.60% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126936113 T -> DEL N N silent_mutation Average:56.553; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1126936113 T -> C LOC_Os11g44530.1 upstream_gene_variant ; 4728.0bp to feature; MODIFIER silent_mutation Average:56.553; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1126936113 T -> C LOC_Os11g44560.1 upstream_gene_variant ; 3906.0bp to feature; MODIFIER silent_mutation Average:56.553; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1126936113 T -> C LOC_Os11g44540.1 downstream_gene_variant ; 3003.0bp to feature; MODIFIER silent_mutation Average:56.553; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1126936113 T -> C LOC_Os11g44550.1 downstream_gene_variant ; 676.0bp to feature; MODIFIER silent_mutation Average:56.553; most accessible tissue: Minghui63 root, score: 94.42 N N N N
vg1126936113 T -> C LOC_Os11g44550-LOC_Os11g44560 intergenic_region ; MODIFIER silent_mutation Average:56.553; most accessible tissue: Minghui63 root, score: 94.42 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126936113 T C -0.01 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126936113 NA 8.97E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126936113 NA 5.32E-08 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126936113 4.50E-07 3.65E-11 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126936113 NA 2.97E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126936113 NA 1.04E-08 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126936113 NA 9.57E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126936113 NA 1.75E-09 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251