Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126880136:

Variant ID: vg1126880136 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26880136
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, T: 0.05, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

CCACAGCGCCATGGCAGTATCTCAAGTTCTCAACTCTCGGGAGGATTGTGTTCTTGCTACCAAATTTTCGCGGAATTATGGATGGACAAAGGGTCGGTCC[A/T]
GGGAAGGAGATGACTGACGCGGTGAGAGGAATTTTCCTGGAAGTGGGTTGGTGTGGACTGTGAAATGATTTTTTTTTTCTTTAAGGCCGACAAAAGCTTT

Reverse complement sequence

AAAGCTTTTGTCGGCCTTAAAGAAAAAAAAAATCATTTCACAGTCCACACCAACCCACTTCCAGGAAAATTCCTCTCACCGCGTCAGTCATCTCCTTCCC[T/A]
GGACCGACCCTTTGTCCATCCATAATTCCGCGAAAATTTGGTAGCAAGAACACAATCCTCCCGAGAGTTGAGAACTTGAGATACTGCCATGGCGCTGTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	36.50%	3.89%	7.38%	NA
All Indica	2759	48.10%	33.60%	6.31%	11.92%	NA
All Japonica	1512	56.00%	43.70%	0.26%	0.13%	NA
Aus	269	78.10%	16.00%	0.00%	5.95%	NA
Indica I	595	46.70%	52.30%	0.34%	0.67%	NA
Indica II	465	37.40%	26.90%	22.15%	13.55%	NA
Indica III	913	55.50%	23.30%	2.19%	18.95%	NA
Indica Intermediate	786	46.90%	35.50%	6.23%	11.32%	NA
Temperate Japonica	767	27.50%	72.40%	0.00%	0.13%	NA
Tropical Japonica	504	91.10%	8.30%	0.40%	0.20%	NA
Japonica Intermediate	241	73.00%	26.10%	0.83%	0.00%	NA
VI/Aromatic	96	31.20%	64.60%	4.17%	0.00%	NA
Intermediate	90	60.00%	35.60%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126880136	A -> T	LOC_Os11g44420.1	upstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:94.417; most accessible tissue: Minghui63 root, score: 99.082	N	N	N	N
vg1126880136	A -> T	LOC_Os11g44430.1	upstream_gene_variant ; 89.0bp to feature; MODIFIER	silent_mutation	Average:94.417; most accessible tissue: Minghui63 root, score: 99.082	N	N	N	N
vg1126880136	A -> T	LOC_Os11g44440.1	upstream_gene_variant ; 1032.0bp to feature; MODIFIER	silent_mutation	Average:94.417; most accessible tissue: Minghui63 root, score: 99.082	N	N	N	N
vg1126880136	A -> T	LOC_Os11g44430-LOC_Os11g44440	intergenic_region ; MODIFIER	silent_mutation	Average:94.417; most accessible tissue: Minghui63 root, score: 99.082	N	N	N	N
vg1126880136	A -> DEL	N	N	silent_mutation	Average:94.417; most accessible tissue: Minghui63 root, score: 99.082	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1126880136	A	T	-0.04	-0.07	-0.04	-0.02	-0.05	-0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126880136	NA	6.70E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	4.50E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	3.79E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	2.28E-08	mr1332	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	4.16E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	3.20E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	4.05E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	7.07E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	4.43E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126880136	NA	2.66E-06	mr1331_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251