\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126878696:

Variant ID: vg1126878696 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26878696
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.07, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCGCCAACCCGAAGTCCGTCAAGCGCGGCACCCAGTTGCCATCGAGGAGGATGTTGGACGGCTTGATGTCACGGTGGATAATCGGCTGCTCACCGCAG[T/G]
ACTGCAGGTACTCGATGGCCTGCGACACACCTAGCAGTATTTCCATGCGTGTCTTCCAGGACGCCATCACTGGCGACGACGACGACGACGACGTTGGGCC

Reverse complement sequence

GGCCCAACGTCGTCGTCGTCGTCGTCGCCAGTGATGGCGTCCTGGAAGACACGCATGGAAATACTGCTAGGTGTGTCGCAGGCCATCGAGTACCTGCAGT[A/C]
CTGCGGTGAGCAGCCGATTATCCACCGTGACATCAAGCCGTCCAACATCCTCCTCGATGGCAACTGGGTGCCGCGCTTGACGGACTTCGGGTTGGCGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.20% 34.40% 3.39% 10.03% NA
All Indica  2759 54.30% 27.70% 3.84% 14.21% NA
All Japonica  1512 46.00% 50.00% 0.46% 3.57% NA
Aus  269 68.80% 18.20% 4.09% 8.92% NA
Indica I  595 51.90% 34.80% 8.07% 5.21% NA
Indica II  465 63.00% 33.30% 0.86% 2.80% NA
Indica III  913 52.80% 23.00% 1.31% 22.89% NA
Indica Intermediate  786 52.50% 24.40% 5.34% 17.68% NA
Temperate Japonica  767 22.40% 72.90% 0.13% 4.56% NA
Tropical Japonica  504 72.00% 24.40% 0.40% 3.17% NA
Japonica Intermediate  241 66.40% 30.70% 1.66% 1.24% NA
VI/Aromatic  96 49.00% 18.80% 32.29% 0.00% NA
Intermediate  90 46.70% 43.30% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126878696 T -> DEL LOC_Os11g44430.1 N frameshift_variant Average:70.573; most accessible tissue: Zhenshan97 root, score: 88.318 N N N N
vg1126878696 T -> G LOC_Os11g44430.1 missense_variant ; p.Tyr334Ser; MODERATE nonsynonymous_codon ; Y334S Average:70.573; most accessible tissue: Zhenshan97 root, score: 88.318 possibly damaging -1.865 TOLERATED 0.82

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126878696 T G -0.04 -0.02 -0.02 -0.03 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126878696 NA 3.41E-07 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878696 NA 6.36E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878696 NA 3.53E-07 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878696 4.53E-06 4.53E-06 mr1548_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251