\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126878291:

Variant ID: vg1126878291 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26878291
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.22, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCACCAGTTCCACCGCTTGCAGCTGCCTCGGCGTTGGCTCTGCTGATGGCCGCCTGTCCAGCACCTTCCGTAGATTACCCTCCTCAATCAGTGGCAGC[G/A]
CGAAGGACACCAAGTCCCTCCTCTTTTTCAAATCCTCGTGGAGTTTTTGCGTCGTGTCCTCTTTCTCCCATTCTTCTCTCTTCTGCGCCTCTTCTTCACA

Reverse complement sequence

TGTGAAGAAGAGGCGCAGAAGAGAGAAGAATGGGAGAAAGAGGACACGACGCAAAAACTCCACGAGGATTTGAAAAAGAGGAGGGACTTGGTGTCCTTCG[C/T]
GCTGCCACTGATTGAGGAGGGTAATCTACGGAAGGTGCTGGACAGGCGGCCATCAGCAGAGCCAACGCCGAGGCAGCTGCAAGCGGTGGAACTGGTGGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 35.00% 5.40% 9.59% NA
All Indica  2759 47.00% 31.00% 8.12% 13.88% NA
All Japonica  1512 55.20% 41.00% 1.12% 2.71% NA
Aus  269 34.20% 52.80% 4.09% 8.92% NA
Indica I  595 67.20% 22.50% 1.34% 8.91% NA
Indica II  465 61.50% 18.70% 15.70% 4.09% NA
Indica III  913 30.60% 42.20% 9.53% 17.74% NA
Indica Intermediate  786 42.40% 31.60% 7.12% 18.96% NA
Temperate Japonica  767 75.50% 19.90% 1.17% 3.39% NA
Tropical Japonica  504 29.60% 67.10% 0.60% 2.78% NA
Japonica Intermediate  241 44.00% 53.50% 2.07% 0.41% NA
VI/Aromatic  96 90.60% 8.30% 1.04% 0.00% NA
Intermediate  90 60.00% 32.20% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126878291 G -> A LOC_Os11g44430.1 missense_variant ; p.Ala469Val; MODERATE nonsynonymous_codon ; A469V Average:76.137; most accessible tissue: Zhenshan97 root, score: 90.472 unknown unknown DELETERIOUS 0.04
vg1126878291 G -> DEL LOC_Os11g44430.1 N frameshift_variant Average:76.137; most accessible tissue: Zhenshan97 root, score: 90.472 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126878291 G A -0.01 -0.01 0.0 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126878291 NA 9.40E-06 mr1296 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878291 3.82E-06 1.09E-06 mr1291_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878291 NA 7.90E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878291 NA 2.41E-08 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126878291 NA 1.41E-08 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251