Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126856638:

Variant ID: vg1126856638 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26856638
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAGCCTTATGAATCCTGGACTACATGGCCCAAAAGTTAAAGTATCTGTTTCTGAATGGAGATGTGTATAGTGGCTGTCGGATCCATTGGCGATTAACC[A/G]
TGACGATGAAACAAGCTCTATGTGCAAATCTGTGATGAAATAGAAAAAGGCTAAAAGAAATAGTGAGATCAAGGGGGAGAATGTTAGATAGATCTCCCTC

Reverse complement sequence

GAGGGAGATCTATCTAACATTCTCCCCCTTGATCTCACTATTTCTTTTAGCCTTTTTCTATTTCATCACAGATTTGCACATAGAGCTTGTTTCATCGTCA[T/C]
GGTTAATCGCCAATGGATCCGACAGCCACTATACACATCTCCATTCAGAAACAGATACTTTAACTTTTGGGCCATGTAGTCCAGGATTCATAAGGCTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.70%	26.20%	1.46%	36.63%	NA
All Indica	2759	26.10%	15.20%	1.34%	57.45%	NA
All Japonica	1512	51.10%	42.50%	1.39%	5.09%	NA
Aus	269	25.30%	53.20%	2.97%	18.59%	NA
Indica I	595	34.10%	12.30%	0.50%	53.11%	NA
Indica II	465	23.00%	19.10%	2.80%	55.05%	NA
Indica III	913	24.60%	10.40%	0.77%	64.18%	NA
Indica Intermediate	786	23.40%	20.50%	1.78%	54.33%	NA
Temperate Japonica	767	21.90%	73.10%	0.78%	4.17%	NA
Tropical Japonica	504	89.30%	4.60%	2.58%	3.57%	NA
Japonica Intermediate	241	63.90%	24.10%	0.83%	11.20%	NA
VI/Aromatic	96	88.50%	9.40%	0.00%	2.08%	NA
Intermediate	90	50.00%	27.80%	3.33%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126856638	A -> DEL	N	N	silent_mutation	Average:36.817; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1126856638	A -> G	LOC_Os11g44390.1	upstream_gene_variant ; 4881.0bp to feature; MODIFIER	silent_mutation	Average:36.817; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg1126856638	A -> G	LOC_Os11g44400.1	intron_variant ; MODIFIER	silent_mutation	Average:36.817; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126856638	NA	3.55E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126856638	1.69E-06	8.24E-07	mr1923_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126856638	1.07E-07	1.37E-07	mr1933_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251