\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126856638:

Variant ID: vg1126856638 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26856638
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAGCCTTATGAATCCTGGACTACATGGCCCAAAAGTTAAAGTATCTGTTTCTGAATGGAGATGTGTATAGTGGCTGTCGGATCCATTGGCGATTAACC[A/G]
TGACGATGAAACAAGCTCTATGTGCAAATCTGTGATGAAATAGAAAAAGGCTAAAAGAAATAGTGAGATCAAGGGGGAGAATGTTAGATAGATCTCCCTC

Reverse complement sequence

GAGGGAGATCTATCTAACATTCTCCCCCTTGATCTCACTATTTCTTTTAGCCTTTTTCTATTTCATCACAGATTTGCACATAGAGCTTGTTTCATCGTCA[T/C]
GGTTAATCGCCAATGGATCCGACAGCCACTATACACATCTCCATTCAGAAACAGATACTTTAACTTTTGGGCCATGTAGTCCAGGATTCATAAGGCTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 26.20% 1.46% 36.63% NA
All Indica  2759 26.10% 15.20% 1.34% 57.45% NA
All Japonica  1512 51.10% 42.50% 1.39% 5.09% NA
Aus  269 25.30% 53.20% 2.97% 18.59% NA
Indica I  595 34.10% 12.30% 0.50% 53.11% NA
Indica II  465 23.00% 19.10% 2.80% 55.05% NA
Indica III  913 24.60% 10.40% 0.77% 64.18% NA
Indica Intermediate  786 23.40% 20.50% 1.78% 54.33% NA
Temperate Japonica  767 21.90% 73.10% 0.78% 4.17% NA
Tropical Japonica  504 89.30% 4.60% 2.58% 3.57% NA
Japonica Intermediate  241 63.90% 24.10% 0.83% 11.20% NA
VI/Aromatic  96 88.50% 9.40% 0.00% 2.08% NA
Intermediate  90 50.00% 27.80% 3.33% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126856638 A -> DEL N N silent_mutation Average:36.817; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1126856638 A -> G LOC_Os11g44390.1 upstream_gene_variant ; 4881.0bp to feature; MODIFIER silent_mutation Average:36.817; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N
vg1126856638 A -> G LOC_Os11g44400.1 intron_variant ; MODIFIER silent_mutation Average:36.817; most accessible tissue: Minghui63 young leaf, score: 70.655 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126856638 NA 3.55E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126856638 1.69E-06 8.24E-07 mr1923_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126856638 1.07E-07 1.37E-07 mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251