\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126793847:

Variant ID: vg1126793847 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26793847
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.19, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAGTCTCGCACATCCCCAACAGTTTCGTTTTTTATTTGCCCATTTTGTTTGAACCCACTAAAATCAATAGAAAAATATTACGAATATGGGGCTTCATG[C/T]
TAAATTCCATTGGGATATATACTTAGGTGTTTTCTCGGGAAATTGAAACGAAAGCTTCATCTGAAAAGTATCAGTTGTCAAAAAAAAAAAAAAGAAGCAT

Reverse complement sequence

ATGCTTCTTTTTTTTTTTTTTGACAACTGATACTTTTCAGATGAAGCTTTCGTTTCAATTTCCCGAGAAAACACCTAAGTATATATCCCAATGGAATTTA[G/A]
CATGAAGCCCCATATTCGTAATATTTTTCTATTGATTTTAGTGGGTTCAAACAAAATGGGCAAATAAAAAACGAAACTGTTGGGGATGTGCGAGACTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 21.00% 1.04% 18.83% NA
All Indica  2759 42.20% 31.10% 1.41% 25.30% NA
All Japonica  1512 86.00% 5.20% 0.46% 8.27% NA
Aus  269 70.60% 8.90% 0.37% 20.07% NA
Indica I  595 46.20% 43.20% 0.50% 10.08% NA
Indica II  465 20.60% 28.60% 2.58% 48.17% NA
Indica III  913 51.60% 26.70% 0.77% 20.92% NA
Indica Intermediate  786 40.80% 28.60% 2.16% 28.37% NA
Temperate Japonica  767 89.30% 1.30% 0.78% 8.60% NA
Tropical Japonica  504 80.80% 13.30% 0.20% 5.75% NA
Japonica Intermediate  241 86.70% 0.80% 0.00% 12.45% NA
VI/Aromatic  96 90.60% 8.30% 0.00% 1.04% NA
Intermediate  90 58.90% 25.60% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126793847 C -> T LOC_Os11g44330.1 upstream_gene_variant ; 326.0bp to feature; MODIFIER silent_mutation Average:81.267; most accessible tissue: Minghui63 root, score: 93.841 N N N N
vg1126793847 C -> T LOC_Os11g44340.1 upstream_gene_variant ; 590.0bp to feature; MODIFIER silent_mutation Average:81.267; most accessible tissue: Minghui63 root, score: 93.841 N N N N
vg1126793847 C -> T LOC_Os11g44330-LOC_Os11g44340 intergenic_region ; MODIFIER silent_mutation Average:81.267; most accessible tissue: Minghui63 root, score: 93.841 N N N N
vg1126793847 C -> DEL N N silent_mutation Average:81.267; most accessible tissue: Minghui63 root, score: 93.841 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126793847 C T -0.08 -0.05 -0.01 -0.01 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126793847 4.10E-06 4.10E-06 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126793847 NA 3.85E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126793847 NA 2.10E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126793847 NA 3.71E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126793847 NA 2.73E-06 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126793847 3.98E-07 3.98E-07 mr1526 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251