\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126786095:

Variant ID: vg1126786095 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26786095
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCCAAGAATATCATCCCTCCTTGAGGTGCCGGAGGGGCGCCGTCCACTCCGAAGGGTAAGCGGGGCCCTGGATCCGTCCACTAGCAAGGTACAGGCC[T/C]
TGCCTTGCCTTTGGAGGAGAAGGTTGCACGCGGGGCTTCAACATCGTTGAGGGAGGCATTAAATGCCTTACCCACCAACTGTTCGTGCGGCCATGCTGTA

Reverse complement sequence

TACAGCATGGCCGCACGAACAGTTGGTGGGTAAGGCATTTAATGCCTCCCTCAACGATGTTGAAGCCCCGCGTGCAACCTTCTCCTCCAAAGGCAAGGCA[A/G]
GGCCTGTACCTTGCTAGTGGACGGATCCAGGGCCCCGCTTACCCTTCGGAGTGGACGGCGCCCCTCCGGCACCTCAAGGAGGGATGATATTCTTGGGGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 14.10% 0.55% 19.28% NA
All Indica  2759 50.50% 23.00% 0.83% 25.66% NA
All Japonica  1512 90.50% 0.50% 0.13% 8.86% NA
Aus  269 72.90% 5.90% 0.00% 21.19% NA
Indica I  595 57.30% 32.40% 0.50% 9.75% NA
Indica II  465 46.20% 4.50% 1.72% 47.53% NA
Indica III  913 45.50% 32.90% 0.22% 21.47% NA
Indica Intermediate  786 53.80% 15.30% 1.27% 29.64% NA
Temperate Japonica  767 89.40% 0.70% 0.26% 9.65% NA
Tropical Japonica  504 93.70% 0.40% 0.00% 5.95% NA
Japonica Intermediate  241 87.60% 0.00% 0.00% 12.45% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 75.60% 11.10% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126786095 T -> DEL N N silent_mutation Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079 N N N N
vg1126786095 T -> C LOC_Os11g44310.1 downstream_gene_variant ; 2122.0bp to feature; MODIFIER silent_mutation Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079 N N N N
vg1126786095 T -> C LOC_Os11g44330.1 downstream_gene_variant ; 4429.0bp to feature; MODIFIER silent_mutation Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079 N N N N
vg1126786095 T -> C LOC_Os11g44310-LOC_Os11g44330 intergenic_region ; MODIFIER silent_mutation Average:78.422; most accessible tissue: Zhenshan97 root, score: 94.079 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126786095 T C -0.05 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126786095 NA 5.45E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095 9.91E-07 1.26E-07 mr1281 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095 7.53E-06 7.53E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095 NA 4.07E-06 mr1372 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126786095 7.22E-06 7.21E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251