Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126603171:

Variant ID: vg1126603171 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26603171
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTAGTTTTGAAAAGTTATTGCAAAATTTAAAATTATGTTGTCATTGTAATATATTTTAATAATATAATGAGAAAACATATATGCTATTATATGAGAGA[A/T]
AATATAATGATGCTAGCCGCACAATCTGCGCGGGCCACCATGCTAGTTTAATTTTATAACAGCAGAATGATATGGCATATTTTTATCTCTTAATTTGCCG

Reverse complement sequence

CGGCAAATTAAGAGATAAAAATATGCCATATCATTCTGCTGTTATAAAATTAAACTAGCATGGTGGCCCGCGCAGATTGTGCGGCTAGCATCATTATATT[T/A]
TCTCTCATATAATAGCATATATGTTTTCTCATTATATTATTAAAATATATTACAATGACAACATAATTTTAAATTTTGCAATAACTTTTCAAAACTACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.70%	1.80%	8.02%	17.52%	NA
All Indica	2759	75.10%	1.00%	7.00%	16.89%	NA
All Japonica	1512	68.50%	2.80%	10.19%	18.45%	NA
Aus	269	68.40%	2.20%	6.69%	22.68%	NA
Indica I	595	56.50%	0.00%	17.82%	25.71%	NA
Indica II	465	61.30%	0.40%	6.88%	31.40%	NA
Indica III	913	91.60%	2.10%	1.64%	4.71%	NA
Indica Intermediate	786	78.20%	0.90%	5.09%	15.78%	NA
Temperate Japonica	767	79.80%	0.40%	3.39%	16.43%	NA
Tropical Japonica	504	57.10%	6.00%	19.84%	17.06%	NA
Japonica Intermediate	241	56.40%	4.10%	11.62%	27.80%	NA
VI/Aromatic	96	77.10%	6.20%	10.42%	6.25%	NA
Intermediate	90	77.80%	0.00%	4.44%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126603171	A -> T	LOC_Os11g44014.1	upstream_gene_variant ; 3909.0bp to feature; MODIFIER	silent_mutation	Average:21.652; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1126603171	A -> T	LOC_Os11g44014-LOC_Os11g44030	intergenic_region ; MODIFIER	silent_mutation	Average:21.652; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg1126603171	A -> DEL	N	N	silent_mutation	Average:21.652; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126603171	6.07E-06	NA	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126603171	2.48E-06	2.48E-06	mr1159_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126603171	2.00E-06	3.95E-06	mr1665_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126603171	9.45E-06	3.85E-06	mr1689_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126603171	NA	8.42E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251