\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126586760:

Variant ID: vg1126586760 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26586760
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.01, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTCTGAATCTGATATGGAGAATCGGAGACATGATCACTACTATTCACTAGCAACATATGTATAATGTATATGCTACTAGTACTTTTTTTTAGAACAGC[T/C]
ACTAGTACTTAGTTAGTGCTTGCTAACGTATATTAGTATCCACATCATAGATCGATAATTGCCAATTTATCATGTTCTACTACAGTTCGTCATCTTTACT

Reverse complement sequence

AGTAAAGATGACGAACTGTAGTAGAACATGATAAATTGGCAATTATCGATCTATGATGTGGATACTAATATACGTTAGCAAGCACTAACTAAGTACTAGT[A/G]
GCTGTTCTAAAAAAAAGTACTAGTAGCATATACATTATACATATGTTGCTAGTGAATAGTAGTGATCATGTCTCCGATTCTCCATATCAGATTCAGACCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.00% 15.90% 5.99% 48.10% NA
All Indica  2759 19.20% 23.80% 5.55% 51.47% NA
All Japonica  1512 53.00% 1.30% 0.99% 44.71% NA
Aus  269 19.30% 16.70% 29.37% 34.57% NA
Indica I  595 11.80% 29.90% 1.51% 56.81% NA
Indica II  465 12.70% 20.20% 4.30% 62.80% NA
Indica III  913 20.20% 22.70% 9.20% 47.97% NA
Indica Intermediate  786 27.50% 22.60% 5.09% 44.78% NA
Temperate Japonica  767 76.70% 1.60% 1.30% 20.47% NA
Tropical Japonica  504 24.00% 0.60% 0.20% 75.20% NA
Japonica Intermediate  241 38.60% 1.70% 1.66% 58.09% NA
VI/Aromatic  96 12.50% 7.30% 29.17% 51.04% NA
Intermediate  90 27.80% 24.40% 8.89% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126586760 T -> DEL N N silent_mutation Average:65.223; most accessible tissue: Zhenshan97 flower, score: 78.853 N N N N
vg1126586760 T -> C LOC_Os11g43990.1 upstream_gene_variant ; 4575.0bp to feature; MODIFIER silent_mutation Average:65.223; most accessible tissue: Zhenshan97 flower, score: 78.853 N N N N
vg1126586760 T -> C LOC_Os11g44000.1 downstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:65.223; most accessible tissue: Zhenshan97 flower, score: 78.853 N N N N
vg1126586760 T -> C LOC_Os11g44014.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:65.223; most accessible tissue: Zhenshan97 flower, score: 78.853 N N N N
vg1126586760 T -> C LOC_Os11g44000-LOC_Os11g44014 intergenic_region ; MODIFIER silent_mutation Average:65.223; most accessible tissue: Zhenshan97 flower, score: 78.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126586760 NA 1.25E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 3.18E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 4.09E-08 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 2.99E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 2.05E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 1.37E-07 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 1.63E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 3.87E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 2.04E-08 mr1908 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 2.42E-18 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 7.32E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 3.85E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 1.27E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 9.64E-10 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 2.66E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 7.63E-11 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 1.41E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 2.99E-09 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 1.25E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126586760 NA 1.83E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251