\
| Variant ID: vg1126585877 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26585877 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 36. )
TGTTATGAACCTTGTTGTACGGCTGTTTTTTGCATGTGTTCCTTCATTGAAGATTTGCTCCGGTCTAACAAAAAGTACCACGAGGTACCAGTACCTTATG[A/G]
TACTAAATCGTTCCGATCGTTGAACCTAGTTAGGCAGGATGGATATTGTTAGATCCAATAATCGGAAACGACTTGGTACCATGAGGTACTGGTACCTTAC
GTAAGGTACCAGTACCTCATGGTACCAAGTCGTTTCCGATTATTGGATCTAACAATATCCATCCTGCCTAACTAGGTTCAACGATCGGAACGATTTAGTA[T/C]
CATAAGGTACTGGTACCTCGTGGTACTTTTTGTTAGACCGGAGCAAATCTTCAATGAAGGAACACATGCAAAAAACAGCCGTACAACAAGGTTCATAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 36.90% | 0.53% | 1.18% | NA |
| All Indica | 2759 | 66.40% | 31.00% | 0.54% | 1.99% | NA |
| All Japonica | 1512 | 50.30% | 49.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 67.30% | 29.70% | 2.97% | 0.00% | NA |
| Indica I | 595 | 53.80% | 39.20% | 0.84% | 6.22% | NA |
| Indica II | 465 | 74.80% | 24.70% | 0.22% | 0.22% | NA |
| Indica III | 913 | 74.70% | 24.40% | 0.33% | 0.55% | NA |
| Indica Intermediate | 786 | 61.50% | 36.30% | 0.76% | 1.53% | NA |
| Temperate Japonica | 767 | 25.00% | 74.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 64.30% | 35.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126585877 | A -> DEL | N | N | silent_mutation | Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| vg1126585877 | A -> G | LOC_Os11g43990.1 | upstream_gene_variant ; 3692.0bp to feature; MODIFIER | silent_mutation | Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| vg1126585877 | A -> G | LOC_Os11g44014.1 | downstream_gene_variant ; 1449.0bp to feature; MODIFIER | silent_mutation | Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| vg1126585877 | A -> G | LOC_Os11g44000.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126585877 | NA | 3.50E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 4.53E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 9.91E-07 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | 9.38E-06 | 3.11E-09 | mr1295 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 1.56E-06 | mr1295 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 5.67E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 2.36E-06 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 5.14E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 9.37E-09 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | 3.75E-06 | 4.68E-13 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 1.49E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 6.24E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 1.02E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 5.75E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585877 | NA | 4.67E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |