\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126585877:

Variant ID: vg1126585877 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26585877
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTATGAACCTTGTTGTACGGCTGTTTTTTGCATGTGTTCCTTCATTGAAGATTTGCTCCGGTCTAACAAAAAGTACCACGAGGTACCAGTACCTTATG[A/G]
TACTAAATCGTTCCGATCGTTGAACCTAGTTAGGCAGGATGGATATTGTTAGATCCAATAATCGGAAACGACTTGGTACCATGAGGTACTGGTACCTTAC

Reverse complement sequence

GTAAGGTACCAGTACCTCATGGTACCAAGTCGTTTCCGATTATTGGATCTAACAATATCCATCCTGCCTAACTAGGTTCAACGATCGGAACGATTTAGTA[T/C]
CATAAGGTACTGGTACCTCGTGGTACTTTTTGTTAGACCGGAGCAAATCTTCAATGAAGGAACACATGCAAAAAACAGCCGTACAACAAGGTTCATAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 36.90% 0.53% 1.18% NA
All Indica  2759 66.40% 31.00% 0.54% 1.99% NA
All Japonica  1512 50.30% 49.70% 0.07% 0.00% NA
Aus  269 67.30% 29.70% 2.97% 0.00% NA
Indica I  595 53.80% 39.20% 0.84% 6.22% NA
Indica II  465 74.80% 24.70% 0.22% 0.22% NA
Indica III  913 74.70% 24.40% 0.33% 0.55% NA
Indica Intermediate  786 61.50% 36.30% 0.76% 1.53% NA
Temperate Japonica  767 25.00% 74.80% 0.13% 0.00% NA
Tropical Japonica  504 81.90% 18.10% 0.00% 0.00% NA
Japonica Intermediate  241 64.30% 35.70% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126585877 A -> DEL N N silent_mutation Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1126585877 A -> G LOC_Os11g43990.1 upstream_gene_variant ; 3692.0bp to feature; MODIFIER silent_mutation Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1126585877 A -> G LOC_Os11g44014.1 downstream_gene_variant ; 1449.0bp to feature; MODIFIER silent_mutation Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg1126585877 A -> G LOC_Os11g44000.1 intron_variant ; MODIFIER silent_mutation Average:43.499; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126585877 NA 3.50E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 4.53E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 9.91E-07 mr1271 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 9.38E-06 3.11E-09 mr1295 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 1.56E-06 mr1295 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 5.67E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 2.36E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 5.14E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 9.37E-09 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 3.75E-06 4.68E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 1.49E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 6.24E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 1.02E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 5.75E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126585877 NA 4.67E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251