\
| Variant ID: vg1126585651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26585651 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 35. )
TCGGTTGGTCTTGGATCTTAGAGGAATATTCCTCTCCAGGGACTAACCCATTCCGCCCACCCCTAAACCAAACACCCCTAAAAGTGGGTTCGCCCCATCC[T/C]
ATCATATCCTTGCAACCAAACACTACCTCAGATGACATGCAACTGTGCAAGCAATGAGAGGACATCCCCTCGAGGGGTGAAAACAATTTTCCCTATTAAT
ATTAATAGGGAAAATTGTTTTCACCCCTCGAGGGGATGTCCTCTCATTGCTTGCACAGTTGCATGTCATCTGAGGTAGTGTTTGGTTGCAAGGATATGAT[A/G]
GGATGGGGCGAACCCACTTTTAGGGGTGTTTGGTTTAGGGGTGGGCGGAATGGGTTAGTCCCTGGAGAGGAATATTCCTCTAAGATCCAAGACCAACCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 36.80% | 0.99% | 5.27% | NA |
| All Indica | 2759 | 58.90% | 31.00% | 1.30% | 8.74% | NA |
| All Japonica | 1512 | 50.10% | 49.50% | 0.07% | 0.26% | NA |
| Aus | 269 | 67.30% | 29.70% | 2.97% | 0.00% | NA |
| Indica I | 595 | 53.30% | 39.30% | 2.02% | 5.38% | NA |
| Indica II | 465 | 71.60% | 24.50% | 0.43% | 3.44% | NA |
| Indica III | 913 | 57.50% | 24.50% | 1.31% | 16.65% | NA |
| Indica Intermediate | 786 | 57.40% | 36.10% | 1.27% | 5.22% | NA |
| Temperate Japonica | 767 | 24.90% | 74.70% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 81.70% | 18.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 64.30% | 35.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 45.60% | 2.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126585651 | T -> DEL | N | N | silent_mutation | Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg1126585651 | T -> C | LOC_Os11g43990.1 | upstream_gene_variant ; 3466.0bp to feature; MODIFIER | silent_mutation | Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg1126585651 | T -> C | LOC_Os11g44014.1 | downstream_gene_variant ; 1675.0bp to feature; MODIFIER | silent_mutation | Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| vg1126585651 | T -> C | LOC_Os11g44000.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.661; most accessible tissue: Zhenshan97 root, score: 62.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126585651 | NA | 4.57E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 3.73E-06 | mr1271 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 1.97E-08 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 5.82E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 3.17E-07 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 5.07E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 8.76E-09 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 9.46E-06 | mr1958 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | 6.26E-08 | 3.79E-15 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 2.49E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126585651 | NA | 3.71E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |