\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126583494:

Variant ID: vg1126583494 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26583494
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.30, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGGAGATGGATGGTCGAGATGTTCCTCTGGGCTGCACTTTTCTAATAACTAAACAATATTATTGGTCAATTAATTAATTTATGATTATTGGTATTGTA[T/C]
TCAGTCGTGGATTCCTATGTTAGGGATTACCATTTTTCAAGATTCTTATTAATTATGTTAACACCAAATCTTGTTTTATCCTTTTTTTTTTTCCTTTCCA

Reverse complement sequence

TGGAAAGGAAAAAAAAAAAGGATAAAACAAGATTTGGTGTTAACATAATTAATAAGAATCTTGAAAAATGGTAATCCCTAACATAGGAATCCACGACTGA[A/G]
TACAATACCAATAATCATAAATTAATTAATTGACCAATAATATTGTTTAGTTATTAGAAAAGTGCAGCCCAGAGGAACATCTCGACCATCCATCTCCCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.30% 0.10% 2.29% 56.33% NA
All Indica  2759 38.60% 0.10% 2.79% 58.50% NA
All Japonica  1512 49.90% 0.00% 1.72% 48.35% NA
Aus  269 27.90% 0.00% 1.49% 70.63% NA
Indica I  595 70.10% 0.00% 2.52% 27.39% NA
Indica II  465 27.50% 0.00% 1.51% 70.97% NA
Indica III  913 22.00% 0.00% 3.83% 74.15% NA
Indica Intermediate  786 40.60% 0.40% 2.54% 56.49% NA
Temperate Japonica  767 75.10% 0.00% 1.30% 23.60% NA
Tropical Japonica  504 18.30% 0.00% 2.78% 78.97% NA
Japonica Intermediate  241 36.10% 0.00% 0.83% 63.07% NA
VI/Aromatic  96 12.50% 0.00% 0.00% 87.50% NA
Intermediate  90 48.90% 2.20% 1.11% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126583494 T -> DEL N N silent_mutation Average:77.732; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg1126583494 T -> C LOC_Os11g43990.1 upstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:77.732; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg1126583494 T -> C LOC_Os11g44000.1 upstream_gene_variant ; 239.0bp to feature; MODIFIER silent_mutation Average:77.732; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg1126583494 T -> C LOC_Os11g44014.1 downstream_gene_variant ; 3832.0bp to feature; MODIFIER silent_mutation Average:77.732; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg1126583494 T -> C LOC_Os11g43990-LOC_Os11g44000 intergenic_region ; MODIFIER silent_mutation Average:77.732; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126583494 T C 0.06 0.01 0.0 0.02 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126583494 NA 1.83E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 1.14E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 8.12E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 4.40E-07 4.39E-07 mr1666 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 7.51E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 3.50E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 6.25E-08 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 3.78E-06 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 3.52E-07 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 4.05E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 3.81E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 1.67E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 1.21E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 4.54E-08 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 4.33E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 8.38E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 9.16E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 1.59E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 1.32E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126583494 NA 3.41E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251