\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126576144:

Variant ID: vg1126576144 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26576144
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTGAGGGAAGCAAAATAGACTTGTACCACTGATCCTGATATAGTTACGCGTGTGCCTTGCCATTGCATGTGGTGAGCCGATGATGAGGACGATACCA[A/G]
GTCGATCAGGTTTTGCATCATCTCCGCCGCGTTGTCTACTCATCATGCGCACACGCTGTCACCAGTCACCACACCGACGTCCCCGGCCGGCCAGCACGTG

Reverse complement sequence

CACGTGCTGGCCGGCCGGGGACGTCGGTGTGGTGACTGGTGACAGCGTGTGCGCATGATGAGTAGACAACGCGGCGGAGATGATGCAAAACCTGATCGAC[T/C]
TGGTATCGTCCTCATCATCGGCTCACCACATGCAATGGCAAGGCACACGCGTAACTATATCAGGATCAGTGGTACAAGTCTATTTTGCTTCCCTCAACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 22.90% 13.60% 0.70% 62.78% NA
All Indica  2759 26.00% 4.50% 0.91% 68.65% NA
All Japonica  1512 16.60% 33.50% 0.40% 49.47% NA
Aus  269 25.70% 1.10% 0.37% 72.86% NA
Indica I  595 34.80% 5.50% 1.18% 58.49% NA
Indica II  465 18.90% 6.70% 1.94% 72.47% NA
Indica III  913 21.50% 0.00% 0.44% 78.09% NA
Indica Intermediate  786 28.80% 7.50% 0.64% 63.10% NA
Temperate Japonica  767 16.20% 59.60% 0.26% 23.99% NA
Tropical Japonica  504 15.70% 2.60% 0.40% 81.35% NA
Japonica Intermediate  241 19.90% 15.40% 0.83% 63.90% NA
VI/Aromatic  96 10.40% 0.00% 1.04% 88.54% NA
Intermediate  90 37.80% 13.30% 0.00% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126576144 A -> DEL N N silent_mutation Average:44.524; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1126576144 A -> G LOC_Os11g43980.1 downstream_gene_variant ; 2025.0bp to feature; MODIFIER silent_mutation Average:44.524; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1126576144 A -> G LOC_Os11g43990.1 downstream_gene_variant ; 971.0bp to feature; MODIFIER silent_mutation Average:44.524; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1126576144 A -> G LOC_Os11g43980-LOC_Os11g43990 intergenic_region ; MODIFIER silent_mutation Average:44.524; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126576144 7.82E-06 4.10E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 4.04E-06 mr1271 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 8.00E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 1.64E-06 mr1295 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 9.97E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 2.04E-06 1.46E-11 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 1.35E-06 2.62E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 1.01E-10 1.04E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 7.71E-06 NA mr1330_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 8.31E-06 5.85E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 2.48E-06 1.54E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 9.27E-06 2.35E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 4.89E-06 4.07E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 8.53E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 6.25E-06 1.16E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 4.29E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 2.33E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 3.71E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126576144 NA 2.26E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251