\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126571224:

Variant ID: vg1126571224 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26571224
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, T: 0.32, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTTCTGTCACATCATACTAATTTTAACCAAACTTCTAAACTTCAGTGTGAACTAAACACAGCCTAACTTACATGTATGGACAGAGTGACAGACAAACA[G/T]
ATGGCAACAGAAACGACCTATGTATACTATGGTTTGGTGGAAGTAACATGCATGGGGATGGCCTGAATGAACAGCACAAATGTGCAGTGTCACAGTACTA

Reverse complement sequence

TAGTACTGTGACACTGCACATTTGTGCTGTTCATTCAGGCCATCCCCATGCATGTTACTTCCACCAAACCATAGTATACATAGGTCGTTTCTGTTGCCAT[C/A]
TGTTTGTCTGTCACTCTGTCCATACATGTAAGTTAGGCTGTGTTTAGTTCACACTGAAGTTTAGAAGTTTGGTTAAAATTAGTATGATGTGACAGAAAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.60% 30.30% 0.11% 0.00% NA
All Indica  2759 52.30% 47.60% 0.11% 0.00% NA
All Japonica  1512 98.10% 1.80% 0.07% 0.00% NA
Aus  269 80.30% 19.70% 0.00% 0.00% NA
Indica I  595 18.00% 81.80% 0.17% 0.00% NA
Indica II  465 71.60% 28.20% 0.22% 0.00% NA
Indica III  913 53.30% 46.70% 0.00% 0.00% NA
Indica Intermediate  786 65.60% 34.20% 0.13% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.10% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126571224 G -> T LOC_Os11g43980.1 upstream_gene_variant ; 1028.0bp to feature; MODIFIER silent_mutation Average:73.169; most accessible tissue: Callus, score: 87.208 N N N N
vg1126571224 G -> T LOC_Os11g43970-LOC_Os11g43980 intergenic_region ; MODIFIER silent_mutation Average:73.169; most accessible tissue: Callus, score: 87.208 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126571224 G T 0.02 -0.02 -0.03 -0.05 -0.04 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126571224 NA 9.74E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 NA 1.56E-09 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 NA 2.34E-06 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 NA 4.19E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 3.95E-06 6.99E-06 mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 NA 2.06E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 NA 5.12E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 3.45E-06 5.01E-08 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126571224 8.15E-06 5.79E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251