\
| Variant ID: vg1126565937 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26565937 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, C: 0.27, others allele: 0.00, population size: 90. )
TCTCTATCTCTTCTCTATCTTATATCTCCATCTCTATCTCTACTATTATAAAAATTGAAAATATTTTTGCCGGTACTTTGATACGTTATTCATGCATGAG[T/C]
CAGTTCTTAAGTTCGTTTGATTTTGGAATTATGGTTCCGTATTTGAGTCGGGCTTTAAGTTCGTTCGCTTTTCAAAATACAAAAGGAGTCATATAAGATA
TATCTTATATGACTCCTTTTGTATTTTGAAAAGCGAACGAACTTAAAGCCCGACTCAAATACGGAACCATAATTCCAAAATCAAACGAACTTAAGAACTG[A/G]
CTCATGCATGAATAACGTATCAAAGTACCGGCAAAAATATTTTCAATTTTTATAATAGTAGAGATAGAGATGGAGATATAAGATAGAGAAGAGATAGAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.70% | 27.20% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 59.00% | 40.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.40% | 17.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 26.60% | 73.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 61.50% | 38.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 21.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126565937 | T -> C | LOC_Os11g43970.1 | upstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:73.536; most accessible tissue: Minghui63 root, score: 91.96 | N | N | N | N |
| vg1126565937 | T -> C | LOC_Os11g43970-LOC_Os11g43980 | intergenic_region ; MODIFIER | silent_mutation | Average:73.536; most accessible tissue: Minghui63 root, score: 91.96 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126565937 | NA | 5.74E-11 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 7.27E-06 | mr1538 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 4.99E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 2.59E-08 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 7.08E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 3.60E-06 | mr1980 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 6.47E-12 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | 8.86E-06 | 2.10E-09 | mr1517_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 2.16E-09 | mr1538_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 1.83E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 2.67E-07 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126565937 | NA | 1.65E-08 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |