Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1126547985:

Variant ID: vg1126547985 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26547985
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:

CCATCCTGACAAGGTGCAACAGAAGGGTGCAAATCTTCAGCAGAAATATACTGCAGAGAAGGTGTTTGATATTCTTAAGGTGTGTATAGTATCACTGCAT[C/T]
GCAACAAATATTGAAATGCCATATGAAACTTCAATATTTCACGCAGAAGAACTATCATTATTGCACACTGGCAACTAGCAAGTAATAATATGCTAAATAG

Reverse complement sequence

CTATTTAGCATATTATTACTTGCTAGTTGCCAGTGTGCAATAATGATAGTTCTTCTGCGTGAAATATTGAAGTTTCATATGGCATTTCAATATTTGTTGC[G/A]
ATGCAGTGATACTATACACACCTTAAGAATATCAAACACCTTCTCTGCAGTATATTTCTGCTGAAGATTTGCACCCTTCTGTTGCACCTTGTCAGGATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.70%	0.02%	0.00%	NA
All Indica	2759	87.60%	12.40%	0.04%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	70.10%	29.70%	0.17%	0.00%	NA
Indica II	465	84.30%	15.70%	0.00%	0.00%	NA
Indica III	913	98.20%	1.80%	0.00%	0.00%	NA
Indica Intermediate	786	90.30%	9.70%	0.00%	0.00%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126547985	C -> T	LOC_Os11g43960.1	upstream_gene_variant ; 1889.0bp to feature; MODIFIER	silent_mutation	Average:63.092; most accessible tissue: Callus, score: 77.481	N	N	N	N
vg1126547985	C -> T	LOC_Os11g43970.1	downstream_gene_variant ; 4949.0bp to feature; MODIFIER	silent_mutation	Average:63.092; most accessible tissue: Callus, score: 77.481	N	N	N	N
vg1126547985	C -> T	LOC_Os11g43950.1	intron_variant ; MODIFIER	silent_mutation	Average:63.092; most accessible tissue: Callus, score: 77.481	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126547985	NA	1.68E-12	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	1.28E-08	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	7.56E-08	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	3.67E-12	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	1.34E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	7.89E-06	3.74E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	6.62E-08	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	3.77E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	1.36E-07	3.14E-22	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	8.45E-07	3.11E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	7.70E-07	4.05E-11	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	1.03E-06	3.33E-09	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	7.19E-06	mr1522_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	1.51E-07	1.94E-12	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	4.01E-07	1.44E-09	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	3.36E-06	2.15E-09	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	1.95E-06	1.10E-09	mr1662_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	NA	1.58E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	5.48E-06	2.94E-11	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	6.39E-06	7.11E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	5.39E-07	3.59E-12	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	2.31E-06	3.40E-08	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	2.38E-07	7.36E-10	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126547985	1.86E-06	7.56E-08	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251