\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126538466:

Variant ID: vg1126538466 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26538466
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCAGTTTTCTTATACCTACGGACATCGTCAAATGGAAAACACAATTCCAAAAAGCATGCCTTCCATCTGACAAATCCAGGGATAAAATCTCAATTGCT[G/A]
GCACCTTGGTTATGGCTTCCATCGAGTACCGACACCACCCATGATCTACACAATCAACACGGTCTCATAAACATAAATTTAGCAAAAGACAAAGGATCAA

Reverse complement sequence

TTGATCCTTTGTCTTTTGCTAAATTTATGTTTATGAGACCGTGTTGATTGTGTAGATCATGGGTGGTGTCGGTACTCGATGGAAGCCATAACCAAGGTGC[C/T]
AGCAATTGAGATTTTATCCCTGGATTTGTCAGATGGAAGGCATGCTTTTTGGAATTGTGTTTTCCATTTGACGATGTCCGTAGGTATAAGAAAACTGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 33.50% 10.94% 0.63% NA
All Indica  2759 56.90% 30.40% 11.78% 0.91% NA
All Japonica  1512 47.20% 42.10% 10.58% 0.07% NA
Aus  269 69.90% 23.80% 4.83% 1.49% NA
Indica I  595 49.20% 29.10% 20.84% 0.84% NA
Indica II  465 72.50% 15.10% 12.47% 0.00% NA
Indica III  913 58.60% 34.30% 6.46% 0.66% NA
Indica Intermediate  786 51.70% 35.90% 10.69% 1.78% NA
Temperate Japonica  767 21.50% 63.20% 15.25% 0.00% NA
Tropical Japonica  504 78.20% 16.90% 4.96% 0.00% NA
Japonica Intermediate  241 64.30% 27.80% 7.47% 0.41% NA
VI/Aromatic  96 77.10% 16.70% 6.25% 0.00% NA
Intermediate  90 54.40% 31.10% 14.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126538466 G -> A LOC_Os11g43950.1 upstream_gene_variant ; 4371.0bp to feature; MODIFIER silent_mutation Average:68.381; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1126538466 G -> A LOC_Os11g43934-LOC_Os11g43950 intergenic_region ; MODIFIER silent_mutation Average:68.381; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg1126538466 G -> DEL N N silent_mutation Average:68.381; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126538466 5.46E-08 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 3.41E-06 2.03E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 4.22E-06 8.23E-09 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 1.56E-08 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 8.89E-09 3.03E-11 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 1.94E-06 2.28E-07 mr1908 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 6.69E-06 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 1.73E-09 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 1.85E-12 4.94E-17 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 3.80E-06 2.14E-10 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 1.45E-09 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 1.48E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 1.24E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 4.94E-09 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 3.04E-08 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 6.65E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126538466 NA 1.64E-08 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251