\
| Variant ID: vg1126527710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26527710 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 232. )
CTATTACGAACAAACATAATAAATGAAGTACATGTTCTTCAACATTATCTTTGAAAGAACTGAGCTGATCATCCTAGTTTGTTAACTCACTAATGCTACC[G/A]
GTGAGTTGTCATATATTCCATGGTAACTTTATATTTAGCGGATATGTACAAGGAAAAAACAGAAGAATATGGATGAATTCCTTTTTCTTTGAAACAGGAT
ATCCTGTTTCAAAGAAAAAGGAATTCATCCATATTCTTCTGTTTTTTCCTTGTACATATCCGCTAAATATAAAGTTACCATGGAATATATGACAACTCAC[C/T]
GGTAGCATTAGTGAGTTAACAAACTAGGATGATCAGCTCAGTTCTTTCAAAGATAATGTTGAAGAACATGTACTTCATTTATTATGTTTGTTCGTAATAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.30% | 47.50% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 54.10% | 45.70% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 53.60% | 46.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 37.90% | 62.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.40% | 48.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 31.40% | 68.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 67.60% | 32.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 53.80% | 45.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 79.50% | 20.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 22.60% | 77.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 35.70% | 63.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 46.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126527710 | G -> A | LOC_Os11g43934.1 | 3_prime_UTR_variant ; 296.0bp to feature; MODIFIER | silent_mutation | Average:44.589; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| vg1126527710 | G -> A | LOC_Os11g43934.2 | intron_variant ; MODIFIER | silent_mutation | Average:44.589; most accessible tissue: Callus, score: 78.072 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126527710 | 2.68E-08 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 3.11E-07 | 9.34E-11 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 4.67E-06 | 8.33E-09 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 1.49E-09 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 1.44E-10 | 8.04E-14 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 5.68E-06 | 4.18E-07 | mr1908 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 2.22E-11 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | 4.84E-15 | 4.44E-20 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 2.04E-10 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 1.10E-09 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 1.48E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 1.23E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 2.41E-08 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 7.90E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 1.54E-08 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 3.56E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126527710 | NA | 8.52E-09 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |