\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126515106:

Variant ID: vg1126515106 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26515106
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGATCGGGTCGGGCACGGGTAGAGCAAAACCATGCCCGACCCGATGCCCGACATTGCCCGCCCAAACCCTACCTACTAGAGTTAGCGGGCAAAACTCC[G/A]
TGCCCGTACCCATGCCCAGCGGGCGCGGGTATGTCCGGCAGGTACCCAATGGATCTCACATGAATAATAACTTAAAAGATATGTAATTTAACAAAGAGAA

Reverse complement sequence

TTCTCTTTGTTAAATTACATATCTTTTAAGTTATTATTCATGTGAGATCCATTGGGTACCTGCCGGACATACCCGCGCCCGCTGGGCATGGGTACGGGCA[C/T]
GGAGTTTTGCCCGCTAACTCTAGTAGGTAGGGTTTGGGCGGGCAATGTCGGGCATCGGGTCGGGCATGGTTTTGCTCTACCCGTGCCCGACCCGATCCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 7.20% 1.33% 8.97% NA
All Indica  2759 76.30% 11.40% 2.03% 10.29% NA
All Japonica  1512 90.70% 0.70% 0.26% 8.33% NA
Aus  269 98.10% 0.40% 0.00% 1.49% NA
Indica I  595 63.20% 28.10% 4.54% 4.20% NA
Indica II  465 74.40% 15.30% 2.58% 7.74% NA
Indica III  913 81.80% 1.40% 0.66% 16.10% NA
Indica Intermediate  786 80.90% 8.00% 1.40% 9.67% NA
Temperate Japonica  767 86.00% 1.30% 0.26% 12.39% NA
Tropical Japonica  504 94.00% 0.00% 0.40% 5.56% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 92.70% 2.10% 0.00% 5.21% NA
Intermediate  90 76.70% 14.40% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126515106 G -> A LOC_Os11g43900.1 upstream_gene_variant ; 1972.0bp to feature; MODIFIER silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg1126515106 G -> A LOC_Os11g43920.1 upstream_gene_variant ; 2878.0bp to feature; MODIFIER silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg1126515106 G -> A LOC_Os11g43900.2 upstream_gene_variant ; 1972.0bp to feature; MODIFIER silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg1126515106 G -> A LOC_Os11g43910.1 downstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg1126515106 G -> A LOC_Os11g43914.1 downstream_gene_variant ; 2253.0bp to feature; MODIFIER silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg1126515106 G -> A LOC_Os11g43910-LOC_Os11g43914 intergenic_region ; MODIFIER silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N
vg1126515106 G -> DEL N N silent_mutation Average:82.604; most accessible tissue: Zhenshan97 panicle, score: 95.438 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1126515106 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126515106 3.47E-07 2.04E-15 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 2.60E-07 2.69E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 7.25E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 3.35E-07 2.03E-16 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 9.81E-07 2.05E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 1.68E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 3.24E-11 2.58E-26 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 8.68E-12 1.43E-19 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 6.57E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 2.89E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 9.96E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 1.34E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126515106 NA 1.62E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251