\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126496401:

Variant ID: vg1126496401 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26496401
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGAGTACTAATTGCCCCATCAATCATATTTCATTCAAATTTCTCCCTATTTTACCCTCAACCATCTTCCCACTCTCACATAAACACCATTTAATGAG[A/G]
GACACCATAGTCTTTCTTCTCAAACCTTAATATATGCTAAACAACATAGAATTGCAATTATTTTGAGACGGAGGTAGTATTACTCAACCAACAAATCCTT

Reverse complement sequence

AAGGATTTGTTGGTTGAGTAATACTACCTCCGTCTCAAAATAATTGCAATTCTATGTTGTTTAGCATATATTAAGGTTTGAGAAGAAAGACTATGGTGTC[T/C]
CTCATTAAATGGTGTTTATGTGAGAGTGGGAAGATGGTTGAGGGTAAAATAGGGAGAAATTTGAATGAAATATGATTGATGGGGCAATTAGTACTCTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 0.20% 1.48% 7.58% NA
All Indica  2759 86.30% 0.10% 1.34% 12.21% NA
All Japonica  1512 99.20% 0.00% 0.20% 0.60% NA
Aus  269 91.10% 1.50% 7.06% 0.37% NA
Indica I  595 66.70% 0.20% 1.51% 31.60% NA
Indica II  465 84.50% 0.00% 0.22% 15.27% NA
Indica III  913 97.00% 0.10% 1.31% 1.53% NA
Indica Intermediate  786 89.70% 0.30% 1.91% 8.14% NA
Temperate Japonica  767 98.70% 0.00% 0.13% 1.17% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 89.60% 1.00% 9.38% 0.00% NA
Intermediate  90 85.60% 0.00% 2.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126496401 A -> DEL N N silent_mutation Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1126496401 A -> G LOC_Os11g43860.1 upstream_gene_variant ; 4018.0bp to feature; MODIFIER silent_mutation Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1126496401 A -> G LOC_Os11g43860.2 upstream_gene_variant ; 4172.0bp to feature; MODIFIER silent_mutation Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1126496401 A -> G LOC_Os11g43870.1 downstream_gene_variant ; 1085.0bp to feature; MODIFIER silent_mutation Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1126496401 A -> G LOC_Os11g43880.1 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N
vg1126496401 A -> G LOC_Os11g43870-LOC_Os11g43880 intergenic_region ; MODIFIER silent_mutation Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126496401 1.34E-13 1.11E-21 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 5.04E-12 4.24E-15 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 4.12E-07 1.36E-08 mr1561 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 1.14E-06 2.42E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 1.97E-13 1.27E-21 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 1.66E-11 1.70E-15 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 9.37E-06 5.03E-09 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 NA 1.86E-09 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 NA 9.19E-06 mr1875 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 NA 1.17E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 1.65E-18 1.13E-34 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 8.42E-18 1.95E-25 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 8.36E-10 3.54E-11 mr1380_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 1.36E-08 1.38E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 1.05E-09 1.32E-11 mr1561_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 4.74E-08 2.76E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 NA 1.51E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 NA 2.78E-10 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 NA 2.31E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 4.11E-08 2.70E-11 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 4.51E-07 2.03E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 8.03E-09 1.51E-11 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 4.52E-07 2.67E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 8.82E-09 5.85E-09 mr1996_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401 4.07E-07 1.23E-06 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251