Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126496401:

Variant ID: vg1126496401 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26496401
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTAGAGTACTAATTGCCCCATCAATCATATTTCATTCAAATTTCTCCCTATTTTACCCTCAACCATCTTCCCACTCTCACATAAACACCATTTAATGAG[A/G]
GACACCATAGTCTTTCTTCTCAAACCTTAATATATGCTAAACAACATAGAATTGCAATTATTTTGAGACGGAGGTAGTATTACTCAACCAACAAATCCTT

Reverse complement sequence

AAGGATTTGTTGGTTGAGTAATACTACCTCCGTCTCAAAATAATTGCAATTCTATGTTGTTTAGCATATATTAAGGTTTGAGAAGAAAGACTATGGTGTC[T/C]
CTCATTAAATGGTGTTTATGTGAGAGTGGGAAGATGGTTGAGGGTAAAATAGGGAGAAATTTGAATGAAATATGATTGATGGGGCAATTAGTACTCTAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	0.20%	1.48%	7.58%	NA
All Indica	2759	86.30%	0.10%	1.34%	12.21%	NA
All Japonica	1512	99.20%	0.00%	0.20%	0.60%	NA
Aus	269	91.10%	1.50%	7.06%	0.37%	NA
Indica I	595	66.70%	0.20%	1.51%	31.60%	NA
Indica II	465	84.50%	0.00%	0.22%	15.27%	NA
Indica III	913	97.00%	0.10%	1.31%	1.53%	NA
Indica Intermediate	786	89.70%	0.30%	1.91%	8.14%	NA
Temperate Japonica	767	98.70%	0.00%	0.13%	1.17%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	89.60%	1.00%	9.38%	0.00%	NA
Intermediate	90	85.60%	0.00%	2.22%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126496401	A -> DEL	N	N	silent_mutation	Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1126496401	A -> G	LOC_Os11g43860.1	upstream_gene_variant ; 4018.0bp to feature; MODIFIER	silent_mutation	Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1126496401	A -> G	LOC_Os11g43860.2	upstream_gene_variant ; 4172.0bp to feature; MODIFIER	silent_mutation	Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1126496401	A -> G	LOC_Os11g43870.1	downstream_gene_variant ; 1085.0bp to feature; MODIFIER	silent_mutation	Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1126496401	A -> G	LOC_Os11g43880.1	downstream_gene_variant ; 747.0bp to feature; MODIFIER	silent_mutation	Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg1126496401	A -> G	LOC_Os11g43870-LOC_Os11g43880	intergenic_region ; MODIFIER	silent_mutation	Average:45.357; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126496401	1.34E-13	1.11E-21	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	5.04E-12	4.24E-15	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	4.12E-07	1.36E-08	mr1561	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	1.14E-06	2.42E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	1.97E-13	1.27E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	1.66E-11	1.70E-15	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	9.37E-06	5.03E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	NA	1.86E-09	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	NA	9.19E-06	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	NA	1.17E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	1.65E-18	1.13E-34	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	8.42E-18	1.95E-25	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	8.36E-10	3.54E-11	mr1380_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	1.36E-08	1.38E-08	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	1.05E-09	1.32E-11	mr1561_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	4.74E-08	2.76E-08	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	NA	1.51E-09	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	NA	2.78E-10	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	NA	2.31E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	4.11E-08	2.70E-11	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	4.51E-07	2.03E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	8.03E-09	1.51E-11	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	4.52E-07	2.67E-07	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	8.82E-09	5.85E-09	mr1996_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126496401	4.07E-07	1.23E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251