Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126487074:

Variant ID: vg1126487074 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26487074
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TCGATTTTTCCATGCGGGAGCTTAAGTGAGCCGCATGCAAAAATAAGGCCATTTTTGTATGCGGACGTCTTAAGTGGCCCGTATGGGAAAATCGATTTTT[C/T]
CATACGGGCGTCCTAAAGAGCCGTATGCGAAAATGCCGCTCGATTTTTGCAGACGCCACTAGTTATGGTTCGTTTGTAAAAATGATGGGGTCTCGTACAG

Reverse complement sequence

CTGTACGAGACCCCATCATTTTTACAAACGAACCATAACTAGTGGCGTCTGCAAAAATCGAGCGGCATTTTCGCATACGGCTCTTTAGGACGCCCGTATG[G/A]
AAAAATCGATTTTCCCATACGGGCCACTTAAGACGTCCGCATACAAAAATGGCCTTATTTTTGCATGCGGCTCACTTAAGCTCCCGCATGGAAAAATCGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.90%	39.70%	0.36%	8.02%	NA
All Indica	2759	71.70%	15.00%	0.36%	12.98%	NA
All Japonica	1512	22.60%	76.80%	0.07%	0.60%	NA
Aus	269	32.00%	67.70%	0.37%	0.00%	NA
Indica I	595	51.60%	13.60%	0.34%	34.45%	NA
Indica II	465	74.60%	9.00%	0.86%	15.48%	NA
Indica III	913	86.50%	11.90%	0.00%	1.53%	NA
Indica Intermediate	786	67.80%	23.20%	0.51%	8.52%	NA
Temperate Japonica	767	22.90%	75.90%	0.00%	1.17%	NA
Tropical Japonica	504	20.20%	79.80%	0.00%	0.00%	NA
Japonica Intermediate	241	26.10%	73.40%	0.41%	0.00%	NA
VI/Aromatic	96	20.80%	76.00%	3.12%	0.00%	NA
Intermediate	90	34.40%	50.00%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126487074	C -> T	LOC_Os11g43860.1	downstream_gene_variant ; 1298.0bp to feature; MODIFIER	silent_mutation	Average:37.444; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1126487074	C -> T	LOC_Os11g43860.2	downstream_gene_variant ; 1298.0bp to feature; MODIFIER	silent_mutation	Average:37.444; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1126487074	C -> T	LOC_Os11g43840-LOC_Os11g43860	intergenic_region ; MODIFIER	silent_mutation	Average:37.444; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg1126487074	C -> DEL	N	N	silent_mutation	Average:37.444; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126487074	NA	6.40E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	1.07E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	1.53E-06	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	5.39E-08	8.84E-16	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	8.88E-06	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	2.21E-06	3.73E-10	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	7.19E-09	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	1.90E-07	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	8.94E-06	4.21E-09	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	3.07E-08	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	5.94E-06	5.95E-06	mr1983_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126487074	NA	3.18E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251