\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126481520:

Variant ID: vg1126481520 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26481520
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTACATACCCTTCTGCTGGCTTTTCGATTTTTTGGCCTTGGAAGCCAATAGGCACAACCTCGCCATCATGGTATTGGAGAAGACGACGAAGGACGA[A/G]
TCATCCCATGCCCTGCCGAGGTAGACCTTGTCGTCGGCGCCGCCCGAGTCGCCGGCGCCGGCCTCGATGGTGCAGTTGTGGAACGAGAAGCCGAGGAAAG

Reverse complement sequence

CTTTCCTCGGCTTCTCGTTCCACAACTGCACCATCGAGGCCGGCGCCGGCGACTCGGGCGGCGCCGACGACAAGGTCTACCTCGGCAGGGCATGGGATGA[T/C]
TCGTCCTTCGTCGTCTTCTCCAATACCATGATGGCGAGGTTGTGCCTATTGGCTTCCAAGGCCAAAAAATCGAAAAGCCAGCAGAAGGGTATGTAACTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.90% 2.30% 0.44% 23.34% NA
All Indica  2759 58.70% 3.20% 0.76% 37.37% NA
All Japonica  1512 98.20% 0.10% 0.00% 1.65% NA
Aus  269 85.50% 6.30% 0.00% 8.18% NA
Indica I  595 30.40% 0.00% 1.68% 67.90% NA
Indica II  465 28.60% 0.40% 1.29% 69.68% NA
Indica III  913 85.20% 6.70% 0.00% 8.11% NA
Indica Intermediate  786 67.00% 3.20% 0.64% 29.13% NA
Temperate Japonica  767 97.40% 0.00% 0.00% 2.61% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 90.60% 2.10% 0.00% 7.29% NA
Intermediate  90 77.80% 2.20% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126481520 A -> DEL N N silent_mutation Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1126481520 A -> G LOC_Os11g43830.1 upstream_gene_variant ; 3475.0bp to feature; MODIFIER silent_mutation Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1126481520 A -> G LOC_Os11g43840.1 upstream_gene_variant ; 1097.0bp to feature; MODIFIER silent_mutation Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg1126481520 A -> G LOC_Os11g43840-LOC_Os11g43860 intergenic_region ; MODIFIER silent_mutation Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126481520 NA 1.27E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 2.80E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 5.14E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 3.62E-07 2.59E-13 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 3.05E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 1.74E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 2.25E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 8.05E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 2.82E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 2.82E-09 9.77E-14 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 4.05E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 3.00E-11 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 5.60E-07 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 1.66E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 6.93E-10 mr1875_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 2.26E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 2.04E-10 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 1.01E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126481520 NA 7.07E-10 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251