\
| Variant ID: vg1126481520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26481520 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTAGTTACATACCCTTCTGCTGGCTTTTCGATTTTTTGGCCTTGGAAGCCAATAGGCACAACCTCGCCATCATGGTATTGGAGAAGACGACGAAGGACGA[A/G]
TCATCCCATGCCCTGCCGAGGTAGACCTTGTCGTCGGCGCCGCCCGAGTCGCCGGCGCCGGCCTCGATGGTGCAGTTGTGGAACGAGAAGCCGAGGAAAG
CTTTCCTCGGCTTCTCGTTCCACAACTGCACCATCGAGGCCGGCGCCGGCGACTCGGGCGGCGCCGACGACAAGGTCTACCTCGGCAGGGCATGGGATGA[T/C]
TCGTCCTTCGTCGTCTTCTCCAATACCATGATGGCGAGGTTGTGCCTATTGGCTTCCAAGGCCAAAAAATCGAAAAGCCAGCAGAAGGGTATGTAACTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.90% | 2.30% | 0.44% | 23.34% | NA |
| All Indica | 2759 | 58.70% | 3.20% | 0.76% | 37.37% | NA |
| All Japonica | 1512 | 98.20% | 0.10% | 0.00% | 1.65% | NA |
| Aus | 269 | 85.50% | 6.30% | 0.00% | 8.18% | NA |
| Indica I | 595 | 30.40% | 0.00% | 1.68% | 67.90% | NA |
| Indica II | 465 | 28.60% | 0.40% | 1.29% | 69.68% | NA |
| Indica III | 913 | 85.20% | 6.70% | 0.00% | 8.11% | NA |
| Indica Intermediate | 786 | 67.00% | 3.20% | 0.64% | 29.13% | NA |
| Temperate Japonica | 767 | 97.40% | 0.00% | 0.00% | 2.61% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 90.60% | 2.10% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 77.80% | 2.20% | 0.00% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126481520 | A -> DEL | N | N | silent_mutation | Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1126481520 | A -> G | LOC_Os11g43830.1 | upstream_gene_variant ; 3475.0bp to feature; MODIFIER | silent_mutation | Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1126481520 | A -> G | LOC_Os11g43840.1 | upstream_gene_variant ; 1097.0bp to feature; MODIFIER | silent_mutation | Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg1126481520 | A -> G | LOC_Os11g43840-LOC_Os11g43860 | intergenic_region ; MODIFIER | silent_mutation | Average:77.139; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126481520 | NA | 1.27E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 2.80E-09 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 5.14E-06 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | 3.62E-07 | 2.59E-13 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 3.05E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 1.74E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 2.25E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 8.05E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 2.82E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | 2.82E-09 | 9.77E-14 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 4.05E-08 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 3.00E-11 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 5.60E-07 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 1.66E-10 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 6.93E-10 | mr1875_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 2.26E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 2.04E-10 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 1.01E-07 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126481520 | NA | 7.07E-10 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |