\
| Variant ID: vg1126454250 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 26454250 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTACTAGTATATATATTAGCTTTTTGCTACTCGACTACTCTCTCCATCCCATAATATAAGGGATTTTGAGTTTTGTCTCATAATATAAGGGATTTTGAGT[C/T]
TTTACTTATAGTGTTTGACCACTCGTCTTATTCAAAAAAAAATTTATGCAAATATAAAAAACGAAAAGCTGTGCGTAAAGTACTTTGGATAATAAAGTAA
TTACTTTATTATCCAAAGTACTTTACGCACAGCTTTTCGTTTTTTATATTTGCATAAATTTTTTTTTGAATAAGACGAGTGGTCAAACACTATAAGTAAA[G/A]
ACTCAAAATCCCTTATATTATGAGACAAAACTCAAAATCCCTTATATTATGGGATGGAGAGAGTAGTCGAGTAGCAAAAAGCTAATATATATACTAGTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.00% | 33.00% | 2.01% | 0.00% | NA |
| All Indica | 2759 | 82.20% | 15.20% | 2.54% | 0.00% | NA |
| All Japonica | 1512 | 42.10% | 56.50% | 1.32% | 0.00% | NA |
| Aus | 269 | 40.90% | 58.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 82.70% | 13.40% | 3.87% | 0.00% | NA |
| Indica II | 465 | 89.90% | 7.50% | 2.58% | 0.00% | NA |
| Indica III | 913 | 84.20% | 14.00% | 1.75% | 0.00% | NA |
| Indica Intermediate | 786 | 75.10% | 22.50% | 2.42% | 0.00% | NA |
| Temperate Japonica | 767 | 63.50% | 34.60% | 1.96% | 0.00% | NA |
| Tropical Japonica | 504 | 15.10% | 84.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.70% | 68.50% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 46.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1126454250 | C -> T | LOC_Os11g43800.1 | upstream_gene_variant ; 1445.0bp to feature; MODIFIER | silent_mutation | Average:43.17; most accessible tissue: Minghui63 panicle, score: 92.928 | N | N | N | N |
| vg1126454250 | C -> T | LOC_Os11g43790.1 | downstream_gene_variant ; 369.0bp to feature; MODIFIER | silent_mutation | Average:43.17; most accessible tissue: Minghui63 panicle, score: 92.928 | N | N | N | N |
| vg1126454250 | C -> T | LOC_Os11g43790-LOC_Os11g43800 | intergenic_region ; MODIFIER | silent_mutation | Average:43.17; most accessible tissue: Minghui63 panicle, score: 92.928 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1126454250 | NA | 8.52E-14 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1126454250 | NA | 6.07E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 3.51E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 2.76E-07 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 1.77E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 8.07E-09 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 1.84E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | 2.24E-07 | NA | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 1.52E-09 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 7.78E-08 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 1.99E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 3.41E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 1.02E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 2.26E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 2.49E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1126454250 | NA | 9.27E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |