Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126383521:

Variant ID: vg1126383521 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26383521
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, A: 0.23, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTTACTTCGTTTTTCGCGCGCACGCTTTTCAAACTGTTAAACGGTGTATTTTTTTAAAAAAGTTTACATACAAAAGTTGCTTAAAAAATCATATTAAT[C/A,T]
TATTTTTGAGAAAAAAAAATAGCAAATACTTAATTAATCACGTGCTACTGGACCACTCCGTTTGGGTTGAAAACAGTTTCGTGGTGGTTTCCATCTACTA

Reverse complement sequence

TAGTAGATGGAAACCACCACGAAACTGTTTTCAACCCAAACGGAGTGGTCCAGTAGCACGTGATTAATTAAGTATTTGCTATTTTTTTTTCTCAAAAATA[G/T,A]
ATTAATATGATTTTTTAAGCAACTTTTGTATGTAAACTTTTTTAAAAAAATACACCGTTTAACAGTTTGAAAAGCGTGCGCGCGAAAAACGAAGTAAGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	29.40%	0.17%	0.00%	NA
All Indica	2759	58.00%	41.80%	0.25%	0.00%	NA
All Japonica	1512	97.90%	2.10%	0.00%	0.00%	NA
Aus	269	32.30%	67.30%	0.37%	0.00%	NA
Indica I	595	81.50%	18.20%	0.34%	0.00%	NA
Indica II	465	31.80%	68.20%	0.00%	0.00%	NA
Indica III	913	54.80%	44.80%	0.44%	0.00%	NA
Indica Intermediate	786	59.40%	40.50%	0.13%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126383521	C -> T	LOC_Os11g43700.1	upstream_gene_variant ; 2655.0bp to feature; MODIFIER	N	Average:44.697; most accessible tissue: Callus, score: 65.873	N	N	N	N
vg1126383521	C -> T	LOC_Os11g43700-LOC_Os11g43710	intergenic_region ; MODIFIER	N	Average:44.697; most accessible tissue: Callus, score: 65.873	N	N	N	N
vg1126383521	C -> A	LOC_Os11g43700.1	upstream_gene_variant ; 2655.0bp to feature; MODIFIER	silent_mutation	Average:44.697; most accessible tissue: Callus, score: 65.873	N	N	N	N
vg1126383521	C -> A	LOC_Os11g43700-LOC_Os11g43710	intergenic_region ; MODIFIER	silent_mutation	Average:44.697; most accessible tissue: Callus, score: 65.873	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126383521	NA	8.63E-07	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	5.77E-07	mr1185	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	1.48E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	3.20E-06	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	3.47E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	5.61E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	1.63E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	2.05E-10	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	2.01E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	4.39E-06	mr1216_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	1.51E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	3.90E-08	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	9.38E-11	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	6.99E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	4.97E-08	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	3.64E-10	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	1.68E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	7.06E-11	mr1875_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	1.90E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	6.03E-09	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	9.05E-07	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521	NA	4.23E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251