\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126383521:

Variant ID: vg1126383521 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26383521
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, A: 0.23, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTTACTTCGTTTTTCGCGCGCACGCTTTTCAAACTGTTAAACGGTGTATTTTTTTAAAAAAGTTTACATACAAAAGTTGCTTAAAAAATCATATTAAT[C/A,T]
TATTTTTGAGAAAAAAAAATAGCAAATACTTAATTAATCACGTGCTACTGGACCACTCCGTTTGGGTTGAAAACAGTTTCGTGGTGGTTTCCATCTACTA

Reverse complement sequence

TAGTAGATGGAAACCACCACGAAACTGTTTTCAACCCAAACGGAGTGGTCCAGTAGCACGTGATTAATTAAGTATTTGCTATTTTTTTTTCTCAAAAATA[G/T,A]
ATTAATATGATTTTTTAAGCAACTTTTGTATGTAAACTTTTTTAAAAAAATACACCGTTTAACAGTTTGAAAAGCGTGCGCGCGAAAAACGAAGTAAGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.40% 0.17% 0.00% NA
All Indica  2759 58.00% 41.80% 0.25% 0.00% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 32.30% 67.30% 0.37% 0.00% NA
Indica I  595 81.50% 18.20% 0.34% 0.00% NA
Indica II  465 31.80% 68.20% 0.00% 0.00% NA
Indica III  913 54.80% 44.80% 0.44% 0.00% NA
Indica Intermediate  786 59.40% 40.50% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.60% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126383521 C -> T LOC_Os11g43700.1 upstream_gene_variant ; 2655.0bp to feature; MODIFIER N Average:44.697; most accessible tissue: Callus, score: 65.873 N N N N
vg1126383521 C -> T LOC_Os11g43700-LOC_Os11g43710 intergenic_region ; MODIFIER N Average:44.697; most accessible tissue: Callus, score: 65.873 N N N N
vg1126383521 C -> A LOC_Os11g43700.1 upstream_gene_variant ; 2655.0bp to feature; MODIFIER silent_mutation Average:44.697; most accessible tissue: Callus, score: 65.873 N N N N
vg1126383521 C -> A LOC_Os11g43700-LOC_Os11g43710 intergenic_region ; MODIFIER silent_mutation Average:44.697; most accessible tissue: Callus, score: 65.873 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126383521 NA 8.63E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 5.77E-07 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 1.48E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 3.20E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 3.47E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 5.61E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 1.63E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 2.05E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 2.01E-12 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 4.39E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 1.51E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 3.90E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 9.38E-11 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 6.99E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 4.97E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 3.64E-10 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 1.68E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 7.06E-11 mr1875_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 1.90E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 6.03E-09 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 9.05E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126383521 NA 4.23E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251