Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126382552:

Variant ID: vg1126382552 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 26382552
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.15, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTTACCCTTAACTAACATTCCACTCTTACCTCACCATTTAATAAGGACCATCATAGTATTTCTTCTCAAATCTTAATATATGCTAAATAAACTAGAATTA[T/C]
AATTTATATGTGACGGAGGGAGTAGTAATATTTTTAAAGTTTGACTAAGTTTATAGAAAAAAGCAGTAATATTTTCAACCCCAGAAAAATATATTATGAA

Reverse complement sequence

TTCATAATATATTTTTCTGGGGTTGAAAATATTACTGCTTTTTTCTATAAACTTAGTCAAACTTTAAAAATATTACTACTCCCTCCGTCACATATAAATT[A/G]
TAATTCTAGTTTATTTAGCATATATTAAGATTTGAGAAGAAATACTATGATGGTCCTTATTAAATGGTGAGGTAAGAGTGGAATGTTAGTTAAGGGTAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.20%	42.40%	0.32%	0.00%	NA
All Indica	2759	45.10%	54.50%	0.47%	0.00%	NA
All Japonica	1512	76.60%	23.40%	0.00%	0.00%	NA
Aus	269	55.00%	45.00%	0.00%	0.00%	NA
Indica I	595	47.40%	52.30%	0.34%	0.00%	NA
Indica II	465	52.30%	47.10%	0.65%	0.00%	NA
Indica III	913	34.80%	65.00%	0.22%	0.00%	NA
Indica Intermediate	786	50.90%	48.30%	0.76%	0.00%	NA
Temperate Japonica	767	71.10%	28.90%	0.00%	0.00%	NA
Tropical Japonica	504	86.30%	13.70%	0.00%	0.00%	NA
Japonica Intermediate	241	73.90%	26.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	27.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1126382552	T -> C	LOC_Os11g43700.1	upstream_gene_variant ; 1686.0bp to feature; MODIFIER	silent_mutation	Average:23.816; most accessible tissue: Callus, score: 48.204	N	N	N	N
vg1126382552	T -> C	LOC_Os11g43700-LOC_Os11g43710	intergenic_region ; MODIFIER	silent_mutation	Average:23.816; most accessible tissue: Callus, score: 48.204	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1126382552	1.67E-06	7.54E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	6.28E-07	1.79E-10	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	8.47E-06	mr1928	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	1.30E-07	7.20E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	5.18E-06	mr1296_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	7.39E-06	2.17E-07	mr1358_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	1.61E-06	1.61E-06	mr1360_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	1.39E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	3.13E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	1.10E-06	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	7.58E-08	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	1.07E-07	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126382552	NA	2.71E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251