\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1126344361:

Variant ID: vg1126344361 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 26344361
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CATATATCAATTCACAAAATATGCATAAACAAATTAAATTAGATCTATTATATAACAAACGCTTCTAAGCCACCACGTGGCATCCTACAAACGCTACTAA[G/A]
ACGCCACGTAGCACTATAATAAATTAAAGAAATTACTACAAATTAAGAAAACACAAAACATCTAGTCATTCATCTTCATTAAATTAGGTGGACCTATTAT

Reverse complement sequence

ATAATAGGTCCACCTAATTTAATGAAGATGAATGACTAGATGTTTTGTGTTTTCTTAATTTGTAGTAATTTCTTTAATTTATTATAGTGCTACGTGGCGT[C/T]
TTAGTAGCGTTTGTAGGATGCCACGTGGTGGCTTAGAAGCGTTTGTTATATAATAGATCTAATTTAATTTGTTTATGCATATTTTGTGAATTGATATATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.70% 0.00% 0.00% NA
All Indica  2759 82.30% 17.70% 0.00% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 44.20% 55.80% 0.00% 0.00% NA
Indica II  465 84.10% 15.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1126344361 G -> A LOC_Os11g43650-LOC_Os11g43660 intergenic_region ; MODIFIER silent_mutation Average:32.53; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1126344361 NA 3.98E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 NA 6.80E-06 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 3.16E-06 8.76E-11 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 NA 2.08E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 NA 5.50E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 NA 6.11E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 NA 9.01E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 5.60E-09 2.34E-19 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 1.59E-07 4.10E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 9.97E-07 2.40E-08 mr1667_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1126344361 NA 2.08E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251